Mutagenetix > Incidental Mutations

Incidental Mutation 'R0673:Ncapd3'

61523

Institutional Source

Beutler Lab

Gene Symbol

Ncapd3

Ensembl Gene

ENSMUSG00000035024

Gene Name

non-SMC condensin II complex, subunit D3

Synonyms

4632407J06Rik, B130055D15Rik, 2810487N22Rik

MMRRC Submission

038858-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.964) question?

Stock #

R0673 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

27030175-27095315 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 27087477 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 1254 (N1254K)

Ref Sequence

ENSEMBL: ENSMUSP00000150938 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073127] [ENSMUST00000086198] [ENSMUST00000216677]

Predicted Effect

probably benign
Transcript: ENSMUST00000073127
AA Change: N1254K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000072871
Gene: ENSMUSG00000035024
AA Change: N1254K

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cnd1	949	1148	1.7e-46	PFAM
low complexity region	1192	1200	N/A	INTRINSIC
coiled coil region	1213	1270	N/A	INTRINSIC
low complexity region	1290	1315	N/A	INTRINSIC
low complexity region	1393	1410	N/A	INTRINSIC
low complexity region	1485	1498	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000086198

SMART Domains

Protein: ENSMUSP00000083374
Gene: ENSMUSG00000035024

Domain	Start	End	E-Value	Type
low complexity region	159	170	N/A	INTRINSIC
low complexity region	173	184	N/A	INTRINSIC
Pfam:Cohesin_HEAT	536	560	4.6e-5	PFAM
Pfam:Cnd1	949	1148	6.6e-59	PFAM
low complexity region	1192	1200	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214270

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214432

Predicted Effect

probably benign
Transcript: ENSMUST00000216677
AA Change: N1254K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.4%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Condensin complexes I and II play essential roles in mitotic chromosome assembly and segregation. Both condensins contain 2 invariant structural maintenance of chromosome (SMC) subunits, SMC2 (MIM 605576) and SMC4 (MIM 605575), but they contain different sets of non-SMC subunits. NCAPD3 is 1 of 3 non-SMC subunits that define condensin II (Ono et al., 2003 [PubMed 14532007]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C23Rik	C	T	17: 45,733,073	W86*	probably null	Het
2700049A03Rik	C	T	12: 71,177,868	P894S	probably damaging	Het
Adgrg7	A	T	16: 56,773,486	N122K	possibly damaging	Het
Ankrd13d	A	T	19: 4,273,019		probably null	Het
Blm	A	T	7: 80,499,751		probably null	Het
Caml	C	T	13: 55,631,828	T238M	probably damaging	Het
Casd1	T	A	6: 4,624,440	V411D	possibly damaging	Het
Cdc25b	A	G	2: 131,197,262	N516D	probably benign	Het
Cmya5	A	G	13: 93,089,997	I2861T	probably damaging	Het
Csmd3	A	G	15: 47,913,940	L1294P	probably damaging	Het
Cxxc1	A	G	18: 74,218,913	D287G	possibly damaging	Het
Dgkq	T	C	5: 108,655,589	H217R	probably damaging	Het
Disp2	A	T	2: 118,790,844	I686F	possibly damaging	Het
Dnah6	T	A	6: 73,123,811	N2003I	probably benign	Het
Dsc3	T	A	18: 19,989,590	R92S	probably damaging	Het
Ei24	T	G	9: 36,788,255		probably null	Het
Fgl1	G	T	8: 41,191,624	T281K	probably benign	Het
Gbp3	A	G	3: 142,565,254	T140A	probably benign	Het
Gtpbp3	A	T	8: 71,492,735	I485F	probably damaging	Het
Harbi1	C	T	2: 91,712,535	R114W	probably damaging	Het
Inmt	A	C	6: 55,171,227	V139G	probably damaging	Het
Inpp5j	T	A	11: 3,501,147	M501L	probably benign	Het
Jmjd1c	A	G	10: 67,226,809	N1647S	probably damaging	Het
Lgals9	A	G	11: 78,965,853	F252L	probably damaging	Het
Lingo3	C	A	10: 80,835,784	R104L	probably benign	Het
Lrrc8c	G	A	5: 105,607,678	V440M	probably damaging	Het
Mybpc3	G	A	2: 91,120,427	G36D	probably damaging	Het
Neb	A	G	2: 52,256,124	V2947A	possibly damaging	Het
Nudt12	A	T	17: 59,007,622		probably null	Het
Olfr140	A	C	2: 90,052,252	M24R	probably benign	Het
Olfr167	A	G	16: 19,515,396	M80T	probably damaging	Het
Otop1	T	C	5: 38,287,948	V150A	possibly damaging	Het
Prr14l	C	T	5: 32,828,915	D1079N	probably benign	Het
Rasal1	A	G	5: 120,670,384	T494A	probably benign	Het
Sacs	A	G	14: 61,210,215	K3237E	possibly damaging	Het
Sh3d19	T	C	3: 86,106,973	S415P	probably benign	Het
Sypl	A	T	12: 32,965,421	T40S	probably damaging	Het
Tg	A	T	15: 66,741,484		probably null	Het
Tmed8	A	G	12: 87,174,104	V236A	probably damaging	Het
Vmn1r33	T	C	6: 66,611,799	Y257C	probably damaging	Het
Yme1l1	T	C	2: 23,168,288	F144S	probably benign	Het

Other mutations in Ncapd3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Ncapd3	APN	9	27052353	missense	probably benign
IGL00544:Ncapd3	APN	9	27063338	missense	possibly damaging	0.94
IGL01657:Ncapd3	APN	9	27071824	missense	possibly damaging	0.81
IGL01979:Ncapd3	APN	9	27071965	critical splice donor site	probably null
IGL02073:Ncapd3	APN	9	27063316	missense	probably benign	0.03
IGL02083:Ncapd3	APN	9	27051821	missense	probably damaging	1.00
IGL02383:Ncapd3	APN	9	27050328	missense	probably benign	0.44
IGL02429:Ncapd3	APN	9	27089302	missense	probably benign	0.08
IGL02437:Ncapd3	APN	9	27063968	splice site	probably benign
IGL02861:Ncapd3	APN	9	27069899	missense	probably benign	0.00
IGL03202:Ncapd3	APN	9	27071715	splice site	probably benign
IGL03219:Ncapd3	APN	9	27063873	splice site	probably benign
IGL03252:Ncapd3	APN	9	27051449	missense	probably damaging	1.00
pevensie	UTSW	9	27086046	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0015:Ncapd3	UTSW	9	27051809	missense	probably damaging	1.00
R0084:Ncapd3	UTSW	9	27056111	missense	probably damaging	0.98
R0491:Ncapd3	UTSW	9	27057883	missense	probably damaging	0.97
R0513:Ncapd3	UTSW	9	27064105	splice site	probably benign
R0565:Ncapd3	UTSW	9	27087998	missense	probably benign	0.00
R0601:Ncapd3	UTSW	9	27041507	missense	probably benign	0.05
R0671:Ncapd3	UTSW	9	27087477	missense	probably benign	0.00
R0842:Ncapd3	UTSW	9	27037084	missense	probably benign	0.01
R1178:Ncapd3	UTSW	9	27041421	missense	probably benign
R1366:Ncapd3	UTSW	9	27057940	missense	probably damaging	1.00
R1432:Ncapd3	UTSW	9	27069872	splice site	probably benign
R1439:Ncapd3	UTSW	9	27087566	critical splice donor site	probably null
R1532:Ncapd3	UTSW	9	27083360	nonsense	probably null
R2131:Ncapd3	UTSW	9	27083346	missense	probably damaging	0.98
R2178:Ncapd3	UTSW	9	27088549	missense	probably benign	0.01
R2238:Ncapd3	UTSW	9	27067024	missense	probably benign
R2258:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2259:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2260:Ncapd3	UTSW	9	27056072	missense	probably benign	0.16
R2297:Ncapd3	UTSW	9	27041501	nonsense	probably null
R2877:Ncapd3	UTSW	9	27044487	splice site	probably null
R3612:Ncapd3	UTSW	9	27050357	missense	probably damaging	1.00
R3709:Ncapd3	UTSW	9	27052349	missense	probably benign	0.00
R3791:Ncapd3	UTSW	9	27052635	missense	probably benign	0.27
R4052:Ncapd3	UTSW	9	27089383	splice site	probably null
R4297:Ncapd3	UTSW	9	27052327	missense	probably benign
R4299:Ncapd3	UTSW	9	27052327	missense	probably benign
R4441:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R4572:Ncapd3	UTSW	9	27094615	missense	probably damaging	1.00
R4675:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R4790:Ncapd3	UTSW	9	27051850	missense	probably benign	0.00
R4835:Ncapd3	UTSW	9	27086046	missense	probably damaging	1.00
R4919:Ncapd3	UTSW	9	27051775	missense	possibly damaging	0.95
R4928:Ncapd3	UTSW	9	27071735	nonsense	probably null
R4939:Ncapd3	UTSW	9	27063869	critical splice donor site	probably null
R4980:Ncapd3	UTSW	9	27063295	missense	probably damaging	0.99
R5030:Ncapd3	UTSW	9	27071766	missense	probably damaging	0.98
R5052:Ncapd3	UTSW	9	27051719	missense	probably damaging	1.00
R5180:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5343:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R5656:Ncapd3	UTSW	9	27051645	missense	possibly damaging	0.81
R5840:Ncapd3	UTSW	9	27094758	missense	probably benign	0.00
R5900:Ncapd3	UTSW	9	27066969	missense	probably benign	0.26
R6093:Ncapd3	UTSW	9	27056158	missense	probably damaging	0.99
R6122:Ncapd3	UTSW	9	27063982	missense	probably benign	0.00
R6249:Ncapd3	UTSW	9	27088053	small deletion	probably benign
R6428:Ncapd3	UTSW	9	27052664	splice site	probably null
R6432:Ncapd3	UTSW	9	27044509	missense	probably damaging	0.98
R6441:Ncapd3	UTSW	9	27063416	missense	probably benign	0.03
R6459:Ncapd3	UTSW	9	27051755	missense	probably benign	0.00
R6567:Ncapd3	UTSW	9	27067004	missense	possibly damaging	0.83
R6722:Ncapd3	UTSW	9	27087556	missense	probably benign
R6862:Ncapd3	UTSW	9	27030809	missense	probably damaging	0.98
R7234:Ncapd3	UTSW	9	27050359	missense	probably damaging	0.97
R7286:Ncapd3	UTSW	9	27069958	missense	probably damaging	1.00
R7404:Ncapd3	UTSW	9	27067019	missense	probably benign	0.01
R7541:Ncapd3	UTSW	9	27067040	missense	probably damaging	0.99
R7583:Ncapd3	UTSW	9	27071848	missense	probably damaging	1.00
R7655:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7656:Ncapd3	UTSW	9	27055505	missense	possibly damaging	0.47
R7815:Ncapd3	UTSW	9	27063440	nonsense	probably null
R7876:Ncapd3	UTSW	9	27045223	critical splice donor site	probably null
R7913:Ncapd3	UTSW	9	27048226	nonsense	probably null
R8068:Ncapd3	UTSW	9	27063361	missense	possibly damaging	0.66
R8147:Ncapd3	UTSW	9	27030718	start gained	probably benign
R8197:Ncapd3	UTSW	9	27086033	missense	probably damaging	0.98
R8264:Ncapd3	UTSW	9	27094742	unclassified	probably benign
R8353:Ncapd3	UTSW	9	27071804	missense	probably benign	0.03
R8539:Ncapd3	UTSW	9	27048224	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGACCGGAAACTTCCCGAGAGAC -3'
(R):5'- TTTCCAGGCAAAGTTCCCTCACAG -3'

Sequencing Primer
(F):5'- gccagggctacacaaagaaac -3'
(R):5'- GGGCCTTGGCAAAGAGAAG -3'

Posted On

2013-07-30