Incidental Mutation 'R7986:Syde2'
ID615247
Institutional Source Beutler Lab
Gene Symbol Syde2
Ensembl Gene ENSMUSG00000036863
Gene Namesynapse defective 1, Rho GTPase, homolog 2 (C. elegans)
SynonymsC430017H16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location145987870-146021720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145998788 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 498 (D498E)
Ref Sequence ENSEMBL: ENSMUSP00000041897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039517] [ENSMUST00000200546] [ENSMUST00000212479]
Predicted Effect probably damaging
Transcript: ENSMUST00000039517
AA Change: D498E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000041897
Gene: ENSMUSG00000036863
AA Change: D498E

DomainStartEndE-ValueType
low complexity region 65 98 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 164 185 N/A INTRINSIC
low complexity region 197 221 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
C2 802 902 1.1e0 SMART
RhoGAP 950 1149 1.23e-57 SMART
Blast:RhoGAP 1151 1299 2e-50 BLAST
low complexity region 1300 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200546
AA Change: D230E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142954
Gene: ENSMUSG00000036863
AA Change: D230E

DomainStartEndE-ValueType
low complexity region 355 368 N/A INTRINSIC
C2 534 634 7.2e-3 SMART
RhoGAP 682 881 7.3e-60 SMART
Blast:RhoGAP 883 1031 2e-50 BLAST
low complexity region 1032 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212479
AA Change: D231E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1565 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Syde2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Syde2 APN 3 146014341 missense possibly damaging 0.76
IGL01624:Syde2 APN 3 146007035 missense probably damaging 1.00
IGL02059:Syde2 APN 3 146002172 missense possibly damaging 0.77
IGL02195:Syde2 APN 3 146002156 missense probably damaging 1.00
IGL02498:Syde2 APN 3 145998689 missense probably benign 0.08
IGL02609:Syde2 APN 3 145998520 missense probably benign 0.00
IGL02721:Syde2 APN 3 146002004 missense probably damaging 1.00
IGL02932:Syde2 APN 3 146001476 missense possibly damaging 0.79
IGL02957:Syde2 APN 3 145989179 splice site probably benign
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0062:Syde2 UTSW 3 145998753 missense probably benign 0.00
R0413:Syde2 UTSW 3 146007132 missense probably damaging 1.00
R0505:Syde2 UTSW 3 146014380 missense possibly damaging 0.85
R0535:Syde2 UTSW 3 145989170 critical splice donor site probably null
R0646:Syde2 UTSW 3 146014249 splice site probably null
R1535:Syde2 UTSW 3 146002421 splice site probably benign
R1914:Syde2 UTSW 3 146014316 nonsense probably null
R1915:Syde2 UTSW 3 146014316 nonsense probably null
R1997:Syde2 UTSW 3 145998991 missense probably benign 0.08
R2012:Syde2 UTSW 3 145988408 missense possibly damaging 0.88
R2112:Syde2 UTSW 3 145998486 missense possibly damaging 0.52
R2220:Syde2 UTSW 3 146001958 missense probably benign 0.07
R2990:Syde2 UTSW 3 146001497 missense probably damaging 0.97
R4022:Syde2 UTSW 3 146015725 missense probably benign 0.25
R5077:Syde2 UTSW 3 146002009 missense probably damaging 1.00
R5084:Syde2 UTSW 3 146001409 frame shift probably null
R5084:Syde2 UTSW 3 146001408 nonsense probably null
R5086:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146001408 nonsense probably null
R5087:Syde2 UTSW 3 146007126 missense probably damaging 1.00
R5101:Syde2 UTSW 3 146015638 missense probably damaging 1.00
R5211:Syde2 UTSW 3 146001338 missense probably benign 0.01
R5842:Syde2 UTSW 3 145999020 missense probably benign 0.00
R6025:Syde2 UTSW 3 146007141 splice site probably null
R6352:Syde2 UTSW 3 145998474 nonsense probably null
R6384:Syde2 UTSW 3 145998813 missense probably damaging 1.00
R6769:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6771:Syde2 UTSW 3 145999048 missense probably damaging 0.98
R6970:Syde2 UTSW 3 145988626 missense probably benign 0.15
R6988:Syde2 UTSW 3 146019809 missense probably benign 0.31
R7067:Syde2 UTSW 3 145988264 missense probably benign 0.00
R7146:Syde2 UTSW 3 146007115 nonsense probably null
R7191:Syde2 UTSW 3 146002358 missense probably benign 0.04
R7246:Syde2 UTSW 3 145988755 missense probably benign 0.22
R7271:Syde2 UTSW 3 146020276 missense possibly damaging 0.71
R7307:Syde2 UTSW 3 146015798 missense probably damaging 1.00
R7875:Syde2 UTSW 3 146020265 missense probably damaging 1.00
R7903:Syde2 UTSW 3 145998788 missense probably damaging 1.00
R7958:Syde2 UTSW 3 146020265 missense probably damaging 1.00
R8016:Syde2 UTSW 3 146001972 missense possibly damaging 0.82
R8185:Syde2 UTSW 3 145988912 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTGGCTGTATCAGAGCACCC -3'
(R):5'- CCATTTGACTGTGAGGTCTGCAC -3'

Sequencing Primer
(F):5'- TATCAGAGCACCCTGAGGTCTCAG -3'
(R):5'- TGTGAGGTCTGCACGTCCC -3'
Posted On2019-12-27