Incidental Mutation 'R7986:Reck'
ID615249
Institutional Source Beutler Lab
Gene Symbol Reck
Ensembl Gene ENSMUSG00000028476
Gene Namereversion-inducing-cysteine-rich protein with kazal motifs
SynonymsSt15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43875530-43944806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43927166 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 486 (I486F)
Ref Sequence ENSEMBL: ENSMUSP00000030198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030198]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030198
AA Change: I486F

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000030198
Gene: ENSMUSG00000028476
AA Change: I486F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 632 671 1.18e-2 SMART
KAZAL 708 750 1.46e-2 SMART
KAZAL 753 787 4.26e-2 SMART
low complexity region 877 890 N/A INTRINSIC
low complexity region 927 946 N/A INTRINSIC
low complexity region 950 967 N/A INTRINSIC
Meta Mutation Damage Score 0.0733 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cysteine-rich, extracellular protein with protease inhibitor-like domains whose expression is suppressed strongly in many tumors and cells transformed by various kinds of oncogenes. In normal cells, this membrane-anchored glycoprotein may serve as a negative regulator for matrix metalloproteinase-9, a key enzyme involved in tumor invasion and metastasis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality around E10.5-E11.5, defects in collagen fibrils, basal lamina and vascular development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Reck
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Reck APN 4 43940662 missense probably damaging 1.00
IGL01569:Reck APN 4 43925172 missense probably benign 0.00
IGL02341:Reck APN 4 43925160 missense probably damaging 0.97
IGL02637:Reck APN 4 43898009 missense probably damaging 0.97
IGL02709:Reck APN 4 43913791 missense probably damaging 0.99
IGL02829:Reck APN 4 43891014 missense probably damaging 0.96
IGL02928:Reck APN 4 43912078 missense possibly damaging 0.47
IGL03132:Reck APN 4 43938898 nonsense probably null
PIT4453001:Reck UTSW 4 43895850 missense probably benign 0.00
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0066:Reck UTSW 4 43930936 missense probably damaging 0.97
R0607:Reck UTSW 4 43940719 missense probably benign 0.01
R0626:Reck UTSW 4 43930295 missense probably benign 0.00
R0894:Reck UTSW 4 43922967 missense probably damaging 1.00
R0932:Reck UTSW 4 43922838 missense possibly damaging 0.95
R1564:Reck UTSW 4 43912061 missense probably benign 0.00
R1633:Reck UTSW 4 43922964 missense possibly damaging 0.89
R1772:Reck UTSW 4 43890982 missense probably benign 0.00
R1968:Reck UTSW 4 43913771 splice site probably null
R2105:Reck UTSW 4 43943195 missense probably damaging 0.99
R2225:Reck UTSW 4 43922837 missense probably benign 0.01
R2302:Reck UTSW 4 43931015 missense probably benign 0.28
R2430:Reck UTSW 4 43930202 missense possibly damaging 0.88
R2655:Reck UTSW 4 43938966 missense probably benign 0.01
R3858:Reck UTSW 4 43930261 missense probably benign 0.13
R4027:Reck UTSW 4 43922931 missense probably damaging 1.00
R4028:Reck UTSW 4 43922931 missense probably damaging 1.00
R4029:Reck UTSW 4 43922931 missense probably damaging 1.00
R4080:Reck UTSW 4 43942293 missense possibly damaging 0.95
R4497:Reck UTSW 4 43891001 missense probably benign
R4583:Reck UTSW 4 43931062 critical splice donor site probably null
R4702:Reck UTSW 4 43898060 missense probably damaging 1.00
R5934:Reck UTSW 4 43930979 missense probably damaging 1.00
R6114:Reck UTSW 4 43922895 missense probably damaging 1.00
R6235:Reck UTSW 4 43937450 missense probably damaging 1.00
R7895:Reck UTSW 4 43890970 missense probably benign 0.00
R7903:Reck UTSW 4 43927166 missense possibly damaging 0.49
R7978:Reck UTSW 4 43890970 missense probably benign 0.00
R8047:Reck UTSW 4 43927221 missense probably damaging 1.00
X0062:Reck UTSW 4 43922921 missense probably damaging 1.00
X0067:Reck UTSW 4 43914016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGTACATTGTGATAAGCTGAC -3'
(R):5'- TTGTAGCCCGGGTAAAGACC -3'

Sequencing Primer
(F):5'- GGTACATTGTGATAAGCTGACAAATG -3'
(R):5'- TCCTCTAAGGAAGTGCCAGC -3'
Posted On2019-12-27