Incidental Mutation 'R7986:Acsm2'
ID615260
Institutional Source Beutler Lab
Gene Symbol Acsm2
Ensembl Gene ENSMUSG00000030945
Gene Nameacyl-CoA synthetase medium-chain family member 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119554340-119600690 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 119595992 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 596 (T596S)
Ref Sequence ENSEMBL: ENSMUSP00000095690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084647] [ENSMUST00000098084] [ENSMUST00000123638] [ENSMUST00000167935] [ENSMUST00000208019]
Predicted Effect probably benign
Transcript: ENSMUST00000084647
AA Change: T576S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000081697
Gene: ENSMUSG00000030945
AA Change: T576S

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 8.9e-79 PFAM
Pfam:AMP-binding_C 478 558 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098084
AA Change: T596S

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000095690
Gene: ENSMUSG00000030945
AA Change: T596S

DomainStartEndE-ValueType
Pfam:AMP-binding 82 495 9.7e-71 PFAM
Pfam:AMP-binding_C 503 583 5.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123638
SMART Domains Protein: ENSMUSP00000118276
Gene: ENSMUSG00000030945

DomainStartEndE-ValueType
Pfam:AMP-binding 1 66 6.6e-13 PFAM
Pfam:AMP-binding_C 74 150 1.1e-16 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118174
Gene: ENSMUSG00000030945
AA Change: T211S

DomainStartEndE-ValueType
Pfam:AMP-binding 1 144 5.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167935
AA Change: T571S

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000126670
Gene: ENSMUSG00000030945
AA Change: T571S

DomainStartEndE-ValueType
Pfam:AMP-binding 57 470 9.1e-79 PFAM
Pfam:AMP-binding_C 483 563 3.2e-20 PFAM
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000208019
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Acsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00782:Acsm2 APN 7 119573168 missense probably damaging 1.00
IGL00930:Acsm2 APN 7 119592310 missense possibly damaging 0.91
IGL01472:Acsm2 APN 7 119554536 critical splice donor site probably null
IGL01927:Acsm2 APN 7 119578212 missense possibly damaging 0.75
IGL02550:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02551:Acsm2 APN 7 119573284 missense probably damaging 1.00
IGL02818:Acsm2 APN 7 119573581 intron probably null
IGL03064:Acsm2 APN 7 119575641 missense probably damaging 0.98
PIT4469001:Acsm2 UTSW 7 119578185 missense possibly damaging 0.51
R0395:Acsm2 UTSW 7 119575746 missense probably damaging 1.00
R0416:Acsm2 UTSW 7 119563556 missense probably benign 0.00
R0783:Acsm2 UTSW 7 119573117 missense probably damaging 1.00
R1252:Acsm2 UTSW 7 119573245 missense probably benign 0.15
R1432:Acsm2 UTSW 7 119573575 missense possibly damaging 0.83
R1494:Acsm2 UTSW 7 119575632 missense probably damaging 1.00
R1495:Acsm2 UTSW 7 119578126 missense probably damaging 1.00
R1642:Acsm2 UTSW 7 119563637 missense probably damaging 1.00
R1702:Acsm2 UTSW 7 119573564 missense possibly damaging 0.88
R2082:Acsm2 UTSW 7 119580634 missense probably benign 0.00
R2420:Acsm2 UTSW 7 119563634 missense probably damaging 1.00
R3612:Acsm2 UTSW 7 119591330 missense probably damaging 0.97
R4396:Acsm2 UTSW 7 119595920 missense probably damaging 1.00
R4433:Acsm2 UTSW 7 119554509 missense unknown
R4568:Acsm2 UTSW 7 119563517 missense probably benign 0.00
R4718:Acsm2 UTSW 7 119573603 missense probably damaging 0.96
R5025:Acsm2 UTSW 7 119554496 missense unknown
R5497:Acsm2 UTSW 7 119573320 missense possibly damaging 0.69
R5509:Acsm2 UTSW 7 119573617 missense probably damaging 1.00
R5682:Acsm2 UTSW 7 119563551 missense probably benign 0.12
R5941:Acsm2 UTSW 7 119591098 missense probably damaging 1.00
R5956:Acsm2 UTSW 7 119554481 missense unknown
R6129:Acsm2 UTSW 7 119591247 unclassified probably null
R6212:Acsm2 UTSW 7 119573282 missense probably damaging 1.00
R7026:Acsm2 UTSW 7 119592227 missense probably damaging 1.00
R7227:Acsm2 UTSW 7 119591333 missense probably benign
R7903:Acsm2 UTSW 7 119595992 missense probably benign 0.22
R8002:Acsm2 UTSW 7 119573257 missense possibly damaging 0.81
R8066:Acsm2 UTSW 7 119591325 missense probably damaging 0.99
Z1177:Acsm2 UTSW 7 119578093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCCTTAAGTGCTCACAG -3'
(R):5'- CTGCCCACTTGAATTGACAATTTC -3'

Sequencing Primer
(F):5'- GCAGCTCCTCTTAAAAATTCAGTGC -3'
(R):5'- AGTGTCAAACGTGTCATTGTTC -3'
Posted On2019-12-27