Incidental Mutation 'R7986:Tmtc4'
ID615282
Institutional Source Beutler Lab
Gene Symbol Tmtc4
Ensembl Gene ENSMUSG00000041594
Gene Nametransmembrane and tetratricopeptide repeat containing 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location122918971-122984035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122927648 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 600 (H600Y)
Ref Sequence ENSEMBL: ENSMUSP00000046368 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037726] [ENSMUST00000126867] [ENSMUST00000143189] [ENSMUST00000148661]
Predicted Effect probably benign
Transcript: ENSMUST00000037726
AA Change: H600Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046368
Gene: ENSMUSG00000041594
AA Change: H600Y

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126867
AA Change: H600Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116379
Gene: ENSMUSG00000041594
AA Change: H600Y

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 290 369 3e-35 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143189
SMART Domains Protein: ENSMUSP00000116480
Gene: ENSMUSG00000041594

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 100 122 N/A INTRINSIC
transmembrane domain 165 187 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148661
AA Change: H600Y

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121523
Gene: ENSMUSG00000041594
AA Change: H600Y

DomainStartEndE-ValueType
transmembrane domain 15 34 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
transmembrane domain 147 169 N/A INTRINSIC
transmembrane domain 174 191 N/A INTRINSIC
transmembrane domain 201 220 N/A INTRINSIC
transmembrane domain 227 249 N/A INTRINSIC
transmembrane domain 269 288 N/A INTRINSIC
Pfam:DUF1736 292 366 4.4e-36 PFAM
transmembrane domain 386 408 N/A INTRINSIC
transmembrane domain 413 435 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
TPR 482 515 2.49e-5 SMART
TPR 516 549 9.03e-3 SMART
TPR 550 583 2.49e-5 SMART
TPR 584 617 2.63e-4 SMART
TPR 618 651 5.78e-1 SMART
TPR 652 685 2.19e-1 SMART
TPR 686 719 1.37e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Map3k8 T C 18: 4,349,162 D52G probably benign Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Tmtc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Tmtc4 APN 14 122925954 splice site probably benign
IGL01408:Tmtc4 APN 14 122925954 splice site probably benign
IGL01487:Tmtc4 APN 14 122926031 missense probably benign 0.25
IGL01694:Tmtc4 APN 14 122973212 missense possibly damaging 0.92
IGL01934:Tmtc4 APN 14 122927635 nonsense probably null
IGL02456:Tmtc4 APN 14 122925962 critical splice donor site probably null
IGL03116:Tmtc4 APN 14 122927632 missense probably benign 0.02
IGL03326:Tmtc4 APN 14 122945540 missense probably damaging 0.99
PIT4403001:Tmtc4 UTSW 14 122973229 missense probably benign 0.01
R0344:Tmtc4 UTSW 14 122978160 missense probably damaging 1.00
R0630:Tmtc4 UTSW 14 122926090 splice site probably benign
R0849:Tmtc4 UTSW 14 122945554 missense possibly damaging 0.62
R1129:Tmtc4 UTSW 14 122943153 critical splice donor site probably null
R1601:Tmtc4 UTSW 14 122944826 missense probably benign 0.01
R1835:Tmtc4 UTSW 14 122941988 critical splice acceptor site probably null
R1966:Tmtc4 UTSW 14 122927599 missense probably benign 0.31
R2024:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2025:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2026:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2027:Tmtc4 UTSW 14 122921265 missense probably benign 0.02
R2256:Tmtc4 UTSW 14 122941408 missense probably benign 0.09
R2439:Tmtc4 UTSW 14 122971903 missense probably damaging 1.00
R3001:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3002:Tmtc4 UTSW 14 122932818 critical splice donor site probably null
R3894:Tmtc4 UTSW 14 122921319 intron probably null
R4561:Tmtc4 UTSW 14 122963298 missense probably benign 0.21
R4926:Tmtc4 UTSW 14 122973206 missense probably damaging 1.00
R5000:Tmtc4 UTSW 14 122933331 missense possibly damaging 0.46
R5024:Tmtc4 UTSW 14 122941302 splice site probably null
R5104:Tmtc4 UTSW 14 122932845 missense probably damaging 0.99
R5200:Tmtc4 UTSW 14 122945557 missense probably benign 0.05
R5536:Tmtc4 UTSW 14 122932879 missense probably benign 0.09
R5677:Tmtc4 UTSW 14 122950499 missense probably damaging 1.00
R5768:Tmtc4 UTSW 14 122933153 missense possibly damaging 0.91
R6467:Tmtc4 UTSW 14 122925979 missense possibly damaging 0.80
R7317:Tmtc4 UTSW 14 122978181 missense probably benign 0.00
R7516:Tmtc4 UTSW 14 122943323 missense possibly damaging 0.68
R7539:Tmtc4 UTSW 14 122978289 splice site probably null
R7584:Tmtc4 UTSW 14 122978151 missense probably benign 0.01
R7821:Tmtc4 UTSW 14 122971877 missense probably benign
R7903:Tmtc4 UTSW 14 122927648 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTCACTGGTCTGCATGCC -3'
(R):5'- TGGTTCCTTCTGTAAAGCTCGG -3'

Sequencing Primer
(F):5'- CCTTGGTTAGCCCACAGAATGATG -3'
(R):5'- AAAGCTCGGATTGTGATGGCATC -3'
Posted On2019-12-27