Incidental Mutation 'R7986:Map3k8'
ID615294
Institutional Source Beutler Lab
Gene Symbol Map3k8
Ensembl Gene ENSMUSG00000024235
Gene Namemitogen-activated protein kinase kinase kinase 8
SynonymsTpl2, Tpl-2, c-COT, Cot, Cot/Tpl2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7986 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location4331327-4353015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4349162 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 52 (D52G)
Ref Sequence ENSEMBL: ENSMUSP00000133469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025078] [ENSMUST00000173930]
Predicted Effect probably benign
Transcript: ENSMUST00000025078
AA Change: D52G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025078
Gene: ENSMUSG00000024235
AA Change: D52G

DomainStartEndE-ValueType
Pfam:Pkinase 137 388 1.1e-47 PFAM
Pfam:Pkinase_Tyr 139 386 4.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172805
Predicted Effect probably benign
Transcript: ENSMUST00000173930
AA Change: D52G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133469
Gene: ENSMUSG00000024235
AA Change: D52G

DomainStartEndE-ValueType
SCOP:d1phk__ 146 169 2e-4 SMART
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mutant mice resist endotoxic shock. Their MHC II expression is enhanced. Macrophages' TNF-alpha response to viruses and to all TLR ligands is impaired. Macrophage and T-cell secretion of other cytokines in response to various TLR ligands or OVA is aberrant. Anti-OVA Ig classes are abnormally skewed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700062C07Rik T C 18: 24,475,726 probably null Het
Acsm2 A T 7: 119,595,992 T596S probably benign Het
Aggf1 T C 13: 95,356,458 K548E probably damaging Het
Anapc15 T G 7: 101,897,986 V23G probably benign Het
Atp10a T C 7: 58,658,822 L123P probably damaging Het
Brf2 G A 8: 27,126,093 T88M possibly damaging Het
Ccdc14 A T 16: 34,704,910 H191L probably damaging Het
Cdc42bpg T A 19: 6,313,469 V453E possibly damaging Het
Corin T C 5: 72,301,500 K1110E probably benign Het
Cubn T C 2: 13,468,869 D421G probably damaging Het
D130043K22Rik T G 13: 24,876,012 V622G probably damaging Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Dnah3 A G 7: 120,042,128 S1190P probably damaging Het
Elavl1 T C 8: 4,301,756 K120R probably benign Het
Fubp1 G A 3: 152,214,861 W79* probably null Het
Gm4869 T C 5: 140,476,012 V523A probably damaging Het
Gm5580 A G 6: 116,551,251 T30A probably benign Het
Gsto2 T A 19: 47,884,657 I157N possibly damaging Het
Gucy2d A G 7: 98,459,065 D735G probably damaging Het
H2-D1 A T 17: 35,263,991 I166F probably damaging Het
Hars2 C A 18: 36,786,192 R128S probably damaging Het
Igf1r T C 7: 68,184,752 F496S probably damaging Het
Inf2 T C 12: 112,612,554 V1256A unknown Het
Krt34 A T 11: 100,041,495 M1K probably null Het
Lamtor2 T C 3: 88,552,510 N26D possibly damaging Het
Map3k10 T C 7: 27,657,957 T799A probably damaging Het
Mcm10 T C 2: 4,995,802 T693A probably benign Het
Mgarp G T 3: 51,396,698 A10E Het
Mns1 A T 9: 72,452,811 E414D probably benign Het
Myo16 A G 8: 10,376,265 S341G probably null Het
Nags A T 11: 102,146,677 D198V possibly damaging Het
Nedd4l C T 18: 65,186,367 P464S probably damaging Het
Nsfl1c T C 2: 151,496,602 Y42H probably damaging Het
Obscn T C 11: 59,079,116 M67V probably benign Het
Olfr1367 T A 13: 21,347,876 I316K probably benign Het
Pcsk5 A T 19: 17,572,483 L715Q probably damaging Het
Pfkfb4 A T 9: 108,998,951 N64Y probably damaging Het
Pidd1 A G 7: 141,439,831 F673L probably damaging Het
Pla2g7 A G 17: 43,600,621 probably null Het
Pml T C 9: 58,249,584 E36G probably benign Het
Proser1 C A 3: 53,479,082 S795* probably null Het
Ptprs T A 17: 56,424,960 K1016* probably null Het
Rbfox1 T A 16: 7,224,511 S76R probably benign Het
Reck A T 4: 43,927,166 I486F possibly damaging Het
Rnf103 A T 6: 71,509,154 K256N probably damaging Het
Setd2 A T 9: 110,617,837 N713I Het
Slc38a4 C T 15: 97,008,928 G310S probably benign Het
Slc7a4 C T 16: 17,575,281 R218H probably benign Het
Slc7a7 T C 14: 54,373,909 H344R probably damaging Het
Smarcc1 G A 9: 110,204,266 E810K probably benign Het
Sord T A 2: 122,263,225 M275K probably benign Het
Spire2 C A 8: 123,368,750 P631T probably benign Het
Sult6b1 T C 17: 78,890,850 K207R probably benign Het
Syde2 T A 3: 145,998,788 D498E probably damaging Het
Syne2 C T 12: 76,064,184 T1024M probably damaging Het
Tdrd9 T A 12: 112,051,976 D1276E possibly damaging Het
Tm7sf2 A G 19: 6,071,335 F219S probably damaging Het
Tmcc2 C T 1: 132,360,461 G496D probably benign Het
Tmtc4 G A 14: 122,927,648 H600Y probably benign Het
Vmn1r224 A T 17: 20,420,047 L295F probably benign Het
Vmn1r91 T C 7: 20,101,210 I18T possibly damaging Het
Vwa7 G A 17: 35,017,787 R110H probably damaging Het
Wbp2nl C T 15: 82,306,131 Q87* probably null Het
Other mutations in Map3k8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:Map3k8 APN 18 4334660 missense probably damaging 1.00
IGL02483:Map3k8 APN 18 4349318 utr 5 prime probably benign
IGL03174:Map3k8 APN 18 4349247 missense probably damaging 1.00
Flojo UTSW 18 4339548 missense possibly damaging 0.95
gnostic_gospel UTSW 18 4333965 missense probably damaging 1.00
juicy UTSW 18 4339552 missense probably damaging 0.99
Sluggish UTSW 18 4339608 splice site probably benign
R0304:Map3k8 UTSW 18 4339552 missense probably damaging 0.99
R0569:Map3k8 UTSW 18 4349162 missense probably benign 0.00
R1748:Map3k8 UTSW 18 4334766 missense probably damaging 1.00
R1793:Map3k8 UTSW 18 4332389 nonsense probably null
R2310:Map3k8 UTSW 18 4349001 missense probably benign
R3625:Map3k8 UTSW 18 4333965 missense probably damaging 1.00
R4786:Map3k8 UTSW 18 4340647 nonsense probably null
R4921:Map3k8 UTSW 18 4349124 missense possibly damaging 0.92
R4930:Map3k8 UTSW 18 4349215 nonsense probably null
R4934:Map3k8 UTSW 18 4339548 missense possibly damaging 0.95
R4956:Map3k8 UTSW 18 4339530 missense probably benign 0.00
R5241:Map3k8 UTSW 18 4340750 missense probably damaging 0.98
R5549:Map3k8 UTSW 18 4340762 missense probably damaging 0.98
R6317:Map3k8 UTSW 18 4348979 critical splice donor site probably null
R6326:Map3k8 UTSW 18 4340651 missense probably damaging 1.00
R6910:Map3k8 UTSW 18 4340801 missense probably benign 0.03
R7010:Map3k8 UTSW 18 4334060 missense probably damaging 1.00
R7247:Map3k8 UTSW 18 4334036 missense probably damaging 1.00
R7300:Map3k8 UTSW 18 4349076 missense probably damaging 0.98
R7348:Map3k8 UTSW 18 4340561 missense probably damaging 1.00
R7903:Map3k8 UTSW 18 4349162 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTGTGCATTCAATGAAGCAC -3'
(R):5'- TTCTGTAGACTCCCAGCAGG -3'

Sequencing Primer
(F):5'- TGTGCATTCAATGAAGCACTACCAG -3'
(R):5'- GTAGACTCCCAGCAGGCACTAC -3'
Posted On2019-12-27