Incidental Mutation 'R7987:Sel1l3'
ID615325
Institutional Source Beutler Lab
Gene Symbol Sel1l3
Ensembl Gene ENSMUSG00000029189
Gene Namesel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms2310045A20Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7987 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location53107083-53213927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53139824 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 760 (K760R)
Ref Sequence ENSEMBL: ENSMUSP00000031090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031090]
Predicted Effect probably benign
Transcript: ENSMUST00000031090
AA Change: K760R

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: K760R

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
SEL1 575 609 3.39e1 SMART
SEL1 611 647 1.85e1 SMART
SEL1 694 730 5.27e-5 SMART
SEL1 732 767 2.94e-3 SMART
SEL1 768 800 5.32e-1 SMART
SEL1 801 839 1.23e-5 SMART
SEL1 840 877 8.55e1 SMART
SEL1 952 988 2.56e-3 SMART
low complexity region 1048 1058 N/A INTRINSIC
transmembrane domain 1065 1087 N/A INTRINSIC
low complexity region 1102 1127 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A T 2: 130,792,003 probably null Het
Adam8 G A 7: 139,987,678 T384I probably benign Het
Astn1 T C 1: 158,597,316 F691L probably benign Het
Azgp1 A G 5: 137,987,607 E164G probably damaging Het
Bdp1 A G 13: 100,041,436 V1975A probably benign Het
Cactin T C 10: 81,325,865 Y744H possibly damaging Het
Clstn1 T A 4: 149,614,137 I60N probably benign Het
Col16a1 T A 4: 130,054,208 C240* probably null Het
Col6a5 T C 9: 105,928,521 D1062G unknown Het
Csmd2 T C 4: 128,419,553 L1341P Het
Cyp51 A T 5: 4,100,173 F183L probably damaging Het
Dbnl T A 11: 5,791,779 probably null Het
Ddx60 G A 8: 61,977,890 V820I possibly damaging Het
Dnah11 T A 12: 117,903,268 D4046V possibly damaging Het
Dnttip1 A G 2: 164,747,552 Y89C probably benign Het
Efr3a T A 15: 65,824,678 V144E probably damaging Het
Epha8 T C 4: 136,931,739 Q868R possibly damaging Het
Ercc5 G T 1: 44,175,838 probably null Het
Fam118a A G 15: 85,045,633 S21G probably damaging Het
Fam171b T C 2: 83,853,505 I122T probably damaging Het
Fam205a1 A G 4: 42,850,765 S464P possibly damaging Het
Fam212b T C 3: 105,716,414 C35R probably damaging Het
Fat4 T A 3: 38,887,541 S194R probably damaging Het
Fcho2 T A 13: 98,796,363 T44S possibly damaging Het
Gm17402 C T 3: 67,365,540 R50K unknown Het
Gm21698 C A 5: 25,984,258 L232F probably benign Het
Gm5767 A G 16: 8,683,817 H61R Het
Gpr149 T A 3: 62,594,935 D500V probably benign Het
Gpx8 T A 13: 113,045,501 T133S probably benign Het
Hdlbp A T 1: 93,423,370 I542N probably damaging Het
Hid1 G A 11: 115,355,361 S361F probably damaging Het
Igdcc4 C A 9: 65,134,519 A1076E probably benign Het
Il4ra A G 7: 125,565,673 K7E probably benign Het
Itga9 G T 9: 118,877,226 probably null Het
Kif5c T C 2: 49,701,083 S316P probably damaging Het
Kmt5c A T 7: 4,746,159 T264S probably damaging Het
Lrrc18 A G 14: 33,009,095 N197S probably benign Het
Mcoln1 C A 8: 3,508,356 D203E probably benign Het
Mitf T C 6: 98,013,710 V358A probably damaging Het
Mki67 A T 7: 135,693,087 L3161Q possibly damaging Het
Mmp20 T A 9: 7,644,075 F255I possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Mug1 G A 6: 121,851,465 V279I probably benign Het
Olfr780 T C 10: 129,321,796 Y58H probably damaging Het
Otulin G T 15: 27,630,494 A39E probably benign Het
Pcdh17 A T 14: 84,448,484 D797V possibly damaging Het
Pdlim5 G A 3: 142,312,393 S147L probably damaging Het
Ppp2r1a T G 17: 20,961,741 probably null Het
Ranbp6 T C 19: 29,812,413 I180V probably benign Het
Rbm27 G T 18: 42,332,856 R869L probably damaging Het
Rtn4r A G 16: 18,151,485 D259G probably benign Het
Ryr3 T C 2: 112,781,024 E2271G probably damaging Het
Sbk1 A G 7: 126,292,036 Y214C probably damaging Het
Scg3 C T 9: 75,643,867 E459K probably damaging Het
Scin T G 12: 40,077,000 E449D probably damaging Het
Sh3pxd2a A G 19: 47,320,314 L145S possibly damaging Het
Sh3yl1 A G 12: 30,941,996 D188G probably benign Het
Slc38a1 A T 15: 96,624,040 L13Q possibly damaging Het
Smyd4 T C 11: 75,349,787 I36T possibly damaging Het
Stab2 A T 10: 86,954,192 L570* probably null Het
Tg G T 15: 66,705,279 A1484S probably benign Het
Tm7sf2 A T 19: 6,068,912 N677K probably damaging Het
Tmem235 T G 11: 117,860,891 L47R probably damaging Het
Tmem87a A G 2: 120,379,717 S252P probably damaging Het
Unc13b A G 4: 43,217,075 D458G probably benign Het
Wnt16 A G 6: 22,297,990 Y285C probably damaging Het
Wwc2 A T 8: 47,856,235 N837K unknown Het
Xdh A G 17: 73,922,472 F329L probably benign Het
Yaf2 G T 15: 93,285,585 H115N probably benign Het
Zbtb16 G T 9: 48,832,972 N13K probably damaging Het
Zfhx3 A T 8: 108,951,063 D2915V probably damaging Het
Zfp236 A T 18: 82,609,382 V1564E possibly damaging Het
Zfp407 G T 18: 84,561,256 H577Q not run Het
Other mutations in Sel1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Sel1l3 APN 5 53116333 missense probably damaging 0.96
IGL01585:Sel1l3 APN 5 53154236 missense probably damaging 0.99
IGL01717:Sel1l3 APN 5 53200168 missense probably damaging 0.99
IGL01771:Sel1l3 APN 5 53121841 missense probably damaging 0.99
IGL01926:Sel1l3 APN 5 53200143 missense probably benign 0.26
IGL01963:Sel1l3 APN 5 53200338 missense probably damaging 0.99
IGL02000:Sel1l3 APN 5 53145493 missense probably damaging 1.00
IGL02132:Sel1l3 APN 5 53170405 missense possibly damaging 0.89
IGL02198:Sel1l3 APN 5 53139799 splice site probably benign
IGL02930:Sel1l3 APN 5 53123217 missense possibly damaging 0.65
IGL03146:Sel1l3 APN 5 53154243 missense probably benign 0.00
IGL03175:Sel1l3 APN 5 53121857 missense probably damaging 1.00
R0083:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0108:Sel1l3 UTSW 5 53137902 missense possibly damaging 0.79
R0940:Sel1l3 UTSW 5 53144037 splice site probably benign
R1027:Sel1l3 UTSW 5 53145478 missense possibly damaging 0.68
R1117:Sel1l3 UTSW 5 53172607 missense probably benign 0.00
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1145:Sel1l3 UTSW 5 53131827 missense probably damaging 0.99
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1146:Sel1l3 UTSW 5 53117103 missense possibly damaging 0.79
R1345:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1370:Sel1l3 UTSW 5 53200217 missense possibly damaging 0.86
R1503:Sel1l3 UTSW 5 53137929 missense probably damaging 0.98
R1747:Sel1l3 UTSW 5 53145545 missense possibly damaging 0.91
R1764:Sel1l3 UTSW 5 53170447 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R2872:Sel1l3 UTSW 5 53137883 nonsense probably null
R3434:Sel1l3 UTSW 5 53117090 missense probably benign 0.44
R4043:Sel1l3 UTSW 5 53188054 nonsense probably null
R4074:Sel1l3 UTSW 5 53154287 missense probably damaging 0.99
R4727:Sel1l3 UTSW 5 53144183 critical splice acceptor site probably null
R4788:Sel1l3 UTSW 5 53131833 missense probably benign 0.41
R4900:Sel1l3 UTSW 5 53131842 missense probably damaging 1.00
R5000:Sel1l3 UTSW 5 53200434 missense probably damaging 0.97
R5090:Sel1l3 UTSW 5 53200046 missense probably benign 0.03
R5330:Sel1l3 UTSW 5 53186009 missense possibly damaging 0.80
R5456:Sel1l3 UTSW 5 53200036 missense probably benign 0.13
R5544:Sel1l3 UTSW 5 53200302 missense probably damaging 0.98
R5848:Sel1l3 UTSW 5 53184808 missense possibly damaging 0.91
R6132:Sel1l3 UTSW 5 53200189 missense possibly damaging 0.77
R6188:Sel1l3 UTSW 5 53155719 missense possibly damaging 0.70
R6622:Sel1l3 UTSW 5 53139860 missense probably damaging 0.98
R7015:Sel1l3 UTSW 5 53172574 missense probably benign 0.03
R7200:Sel1l3 UTSW 5 53144109 missense probably benign 0.22
R7271:Sel1l3 UTSW 5 53116362 missense probably damaging 0.98
R7378:Sel1l3 UTSW 5 53116409 missense probably benign 0.02
R7479:Sel1l3 UTSW 5 53117120 missense probably damaging 0.99
R7563:Sel1l3 UTSW 5 53185984 missense probably damaging 1.00
R7643:Sel1l3 UTSW 5 53123162 splice site probably null
R7741:Sel1l3 UTSW 5 53200251 missense probably damaging 1.00
R7743:Sel1l3 UTSW 5 53135885 missense probably benign 0.07
R7861:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
R7904:Sel1l3 UTSW 5 53139824 missense probably benign 0.24
R7944:Sel1l3 UTSW 5 53144064 missense probably damaging 0.96
Z1088:Sel1l3 UTSW 5 53116196 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTTGAACGGTGCTGTCCTCG -3'
(R):5'- GTGTCTTGAAATACTGCTGAGTC -3'

Sequencing Primer
(F):5'- CCTCGTTGTGGCAAGATTATG -3'
(R):5'- CTGCTGAGTCTAGAACTGATTAAGAG -3'
Posted On2019-12-27