Incidental Mutation 'R7988:Ufc1'
ID615380
Institutional Source Beutler Lab
Gene Symbol Ufc1
Ensembl Gene ENSMUSG00000062963
Gene Nameubiquitin-fold modifier conjugating enzyme 1
SynonymsESTM29, 1110021H02Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.677) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location171288563-171295024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 171289935 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 68 (K68N)
Ref Sequence ENSEMBL: ENSMUSP00000078914 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065941] [ENSMUST00000080001] [ENSMUST00000111302] [ENSMUST00000111305] [ENSMUST00000111306] [ENSMUST00000144576] [ENSMUST00000149187]
Predicted Effect probably benign
Transcript: ENSMUST00000065941
SMART Domains Protein: ENSMUSP00000064002
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000080001
AA Change: K68N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078914
Gene: ENSMUSG00000062963
AA Change: K68N

DomainStartEndE-ValueType
Pfam:UFC1 4 164 1.3e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111302
AA Change: K68N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106933
Gene: ENSMUSG00000062963
AA Change: K68N

DomainStartEndE-ValueType
Pfam:UFC1 6 160 1.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111305
SMART Domains Protein: ENSMUSP00000106936
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 556 9.4e-66 PFAM
Pfam:UCH_1 212 538 9.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111306
SMART Domains Protein: ENSMUSP00000106938
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 559 4.1e-60 PFAM
Pfam:UCH_1 215 541 3.6e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144576
AA Change: K68N

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137977
Gene: ENSMUSG00000062963
AA Change: K68N

DomainStartEndE-ValueType
Pfam:UFC1 4 91 2e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149187
SMART Domains Protein: ENSMUSP00000120161
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 150 160 N/A INTRINSIC
Pfam:UCH 211 438 1e-36 PFAM
Pfam:UCH_1 212 436 2.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174720
SMART Domains Protein: ENSMUSP00000133362
Gene: ENSMUSG00000053483

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
low complexity region 40 57 N/A INTRINSIC
Pfam:UCH 77 162 4.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] UFC1 is an E2-like conjugating enzyme for ubiquitin-fold modifier-1 (UFM1; MIM 610553) (Komatsu et al., 2004 [PubMed 15071506]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Ufc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02641:Ufc1 APN 1 171290191 missense probably damaging 1.00
R0452:Ufc1 UTSW 1 171289954 unclassified probably benign
R1226:Ufc1 UTSW 1 171289237 missense probably benign
R2314:Ufc1 UTSW 1 171289248 missense probably damaging 1.00
R3821:Ufc1 UTSW 1 171289599 unclassified probably benign
R4642:Ufc1 UTSW 1 171289894 missense probably benign 0.27
R4855:Ufc1 UTSW 1 171294802 utr 5 prime probably benign
R5390:Ufc1 UTSW 1 171290173 missense probably damaging 1.00
R6382:Ufc1 UTSW 1 171294675 missense probably damaging 1.00
R6419:Ufc1 UTSW 1 171288956 missense probably damaging 1.00
R7905:Ufc1 UTSW 1 171289935 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACACCAGGATTCTAGGCACAG -3'
(R):5'- TGGCTTGAGCAATCTGGTATCTC -3'

Sequencing Primer
(F):5'- TTCTAGGCACAGAGATTAGCAACTC -3'
(R):5'- GCTTGAGCAATCTGGTATCTCATAAC -3'
Posted On2019-12-27