Incidental Mutation 'R7988:Degs1'
ID615381
Institutional Source Beutler Lab
Gene Symbol Degs1
Ensembl Gene ENSMUSG00000038633
Gene Namedelta(4)-desaturase, sphingolipid 1
SynonymsMdes, Des1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182275772-182282804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 182279036 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 255 (N255K)
Ref Sequence ENSEMBL: ENSMUSP00000048519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035295] [ENSMUST00000133052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035295
AA Change: N255K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048519
Gene: ENSMUSG00000038633
AA Change: N255K

DomainStartEndE-ValueType
Lipid_DES 5 43 4.36e-20 SMART
Pfam:FA_desaturase 65 293 1.1e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000133052
AA Change: N219K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119473
Gene: ENSMUSG00000038633
AA Change: N219K

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
transmembrane domain 37 55 N/A INTRINSIC
Pfam:FA_desaturase 59 260 4.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane fatty acid desaturase family which is responsible for inserting double bonds into specific positions in fatty acids. This protein contains three His-containing consensus motifs that are characteristic of a group of membrane fatty acid desaturases. It is predicted to be a multiple membrane-spanning protein localized to the endoplasmic reticulum. Overexpression of this gene inhibited biosynthesis of the EGF receptor, suggesting a possible role of a fatty acid desaturase in regulating biosynthetic processing of the EGF receptor. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased to absent ceramide levels, decreased body weight, scaly skin, sparse hair, tremors, hematological and blood chemistry abnormalities, decreased bone mineral content and density and decreased liver function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Degs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Degs1 APN 1 182279209 missense probably benign 0.34
IGL01766:Degs1 APN 1 182279095 missense probably damaging 1.00
IGL02237:Degs1 APN 1 182279688 missense probably damaging 0.97
IGL02578:Degs1 APN 1 182279027 nonsense probably null
IGL03200:Degs1 APN 1 182279691 start codon destroyed probably null 1.00
R0087:Degs1 UTSW 1 182279310 missense probably benign 0.00
R0126:Degs1 UTSW 1 182279692 start codon destroyed probably null 0.85
R0299:Degs1 UTSW 1 182279271 missense probably damaging 0.99
R4157:Degs1 UTSW 1 182282627 missense possibly damaging 0.83
R4260:Degs1 UTSW 1 182279241 missense probably benign
R4520:Degs1 UTSW 1 182276808 missense possibly damaging 0.95
R4606:Degs1 UTSW 1 182276823 missense probably damaging 0.99
R4888:Degs1 UTSW 1 182276805 missense probably damaging 0.98
R5366:Degs1 UTSW 1 182279362 missense probably benign 0.08
R6574:Degs1 UTSW 1 182279073 missense probably damaging 1.00
R7023:Degs1 UTSW 1 182279065 missense probably damaging 0.99
R7164:Degs1 UTSW 1 182279125 missense probably damaging 0.99
R7633:Degs1 UTSW 1 182279698 missense probably damaging 1.00
R7894:Degs1 UTSW 1 182276851 missense probably damaging 0.97
R7894:Degs1 UTSW 1 182276852 missense probably benign 0.00
R7905:Degs1 UTSW 1 182279036 missense possibly damaging 0.72
R7977:Degs1 UTSW 1 182276851 missense probably damaging 0.97
R7977:Degs1 UTSW 1 182276852 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GACGCTGCATCCTTAGCAAAG -3'
(R):5'- GATCCAGATCACCTTTGACATTATC -3'

Sequencing Primer
(F):5'- CTGTAGACAAAGGATCTATGTCCTCC -3'
(R):5'- TTGCACCCAATTTCTGGG -3'
Posted On2019-12-27