Incidental Mutation 'R7988:Bpifa5'
ID615384
Institutional Source Beutler Lab
Gene Symbol Bpifa5
Ensembl Gene ENSMUSG00000027484
Gene NameBPI fold containing family A, member 5
Synonyms2310074B19Rik, 2310021H06Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location154162607-154168450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 154165588 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 150 (I150T)
Ref Sequence ENSEMBL: ENSMUSP00000028986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028986]
Predicted Effect probably damaging
Transcript: ENSMUST00000028986
AA Change: I150T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028986
Gene: ENSMUSG00000027484
AA Change: I150T

DomainStartEndE-ValueType
Pfam:LBP_BPI_CETP 76 248 5.6e-38 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Bpifa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Bpifa5 APN 2 154167252 missense probably damaging 1.00
R0498:Bpifa5 UTSW 2 154167249 missense probably damaging 1.00
R0501:Bpifa5 UTSW 2 154163696 missense probably benign 0.00
R0521:Bpifa5 UTSW 2 154166949 missense probably benign 0.42
R0601:Bpifa5 UTSW 2 154164255 missense possibly damaging 0.80
R0792:Bpifa5 UTSW 2 154165619 critical splice donor site probably null
R1695:Bpifa5 UTSW 2 154167660 missense probably damaging 1.00
R5072:Bpifa5 UTSW 2 154165972 missense probably damaging 1.00
R5810:Bpifa5 UTSW 2 154163718 splice site probably null
R5837:Bpifa5 UTSW 2 154163678 missense probably damaging 0.98
R6253:Bpifa5 UTSW 2 154163500 start codon destroyed probably null 1.00
R7213:Bpifa5 UTSW 2 154165983 missense possibly damaging 0.69
R7686:Bpifa5 UTSW 2 154165512 missense probably benign 0.02
R7905:Bpifa5 UTSW 2 154165588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCAGAACACAAGGTGG -3'
(R):5'- GGTCAAGTGTGTTTTCCATATGACC -3'

Sequencing Primer
(F):5'- CAGAACACAAGGTGGTTCTGATTCC -3'
(R):5'- CCATATGACCTGAGTTTGTTCAACAC -3'
Posted On2019-12-27