Incidental Mutation 'R7988:Cd40'
ID615385
Institutional Source Beutler Lab
Gene Symbol Cd40
Ensembl Gene ENSMUSG00000017652
Gene NameCD40 antigen
SynonymsBp50, Cd40, p50, Tnfrsf5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location165055627-165072948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 165062325 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 31 (Y31H)
Ref Sequence ENSEMBL: ENSMUSP00000017799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017799] [ENSMUST00000073707] [ENSMUST00000081310] [ENSMUST00000140951] [ENSMUST00000154443] [ENSMUST00000184221]
Predicted Effect probably damaging
Transcript: ENSMUST00000017799
AA Change: Y31H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017799
Gene: ENSMUSG00000017652
AA Change: Y31H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000073707
AA Change: Y31H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073386
Gene: ENSMUSG00000017652
AA Change: Y31H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081310
AA Change: Y31H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080059
Gene: ENSMUSG00000017652
AA Change: Y31H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000140951
AA Change: Y69H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122981
Gene: ENSMUSG00000017652
AA Change: Y69H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
TNFR 64 97 9.45e-6 SMART
Blast:TNFR 100 121 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154443
Predicted Effect probably damaging
Transcript: ENSMUST00000184221
AA Change: Y31H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139193
Gene: ENSMUSG00000017652
AA Change: Y31H

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
TNFR 26 59 9.45e-6 SMART
TNFR 62 103 2.38e-11 SMART
TNFR 105 143 4.55e-8 SMART
TNFR 146 186 2.42e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TNF-receptor superfamily. The encoded protein is a receptor on antigen-presenting cells of the immune system and is essential for mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. AT-hook transcription factor AKNA is reported to coordinately regulate the expression of this receptor and its ligand, which may be important for homotypic cell interactions. Adaptor protein TNFR2 interacts with this receptor and serves as a mediator of the signal transduction. The interaction of this receptor and its ligand is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis. Mutations affecting this gene are the cause of autosomal recessive hyper-IgM immunodeficiency type 3 (HIGM3). Multiple alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene may cause impaired immunoglobulin class switching and germinal center formation, reduced susceptibility to type II hypersensitivity reaction, impaired priming of T cells and control of M. tuberculosis infection, and altered response to transplant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Cd40
AlleleSourceChrCoordTypePredicted EffectPPH Score
bluebonnet UTSW 2 165062301 missense probably benign 0.23
noelle UTSW 2 165063563 critical splice donor site probably null
R0553:Cd40 UTSW 2 165070741 missense probably benign 0.01
R1115:Cd40 UTSW 2 165070761 missense possibly damaging 0.59
R1134:Cd40 UTSW 2 165070818 missense probably benign 0.44
R2036:Cd40 UTSW 2 165062301 missense probably benign 0.23
R2938:Cd40 UTSW 2 165069702 missense probably benign 0.01
R3034:Cd40 UTSW 2 165062315 missense probably benign 0.02
R4690:Cd40 UTSW 2 165069695 missense possibly damaging 0.68
R5222:Cd40 UTSW 2 165066544 missense probably benign 0.41
R5310:Cd40 UTSW 2 165063563 critical splice donor site probably null
R7318:Cd40 UTSW 2 165062335 missense possibly damaging 0.51
R7833:Cd40 UTSW 2 165066511 missense probably benign 0.01
R7905:Cd40 UTSW 2 165062325 missense probably damaging 1.00
R7916:Cd40 UTSW 2 165066511 missense probably benign 0.01
R8069:Cd40 UTSW 2 165056775 missense unknown
Z1088:Cd40 UTSW 2 165063040 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAGTCCTGTGCATCTGTTCG -3'
(R):5'- GGGGTATTCTGGCATCAAGG -3'

Sequencing Primer
(F):5'- GCTTTGGTAGATGGCAGTAAGAC -3'
(R):5'- TATTCTGGCATCAAGGAAGAGG -3'
Posted On2019-12-27