Incidental Mutation 'R7988:Cnbd1'
ID615388
Institutional Source Beutler Lab
Gene Symbol Cnbd1
Ensembl Gene ENSMUSG00000073991
Gene Namecyclic nucleotide binding domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location18860454-19122526 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18907100 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 158 (K158R)
Ref Sequence ENSEMBL: ENSMUSP00000121576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137780]
Predicted Effect possibly damaging
Transcript: ENSMUST00000137780
AA Change: K158R

PolyPhen 2 Score 0.809 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121576
Gene: ENSMUSG00000073991
AA Change: K158R

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Blast:cNMP 166 225 6e-6 BLAST
SCOP:d1cx4a1 296 430 3e-13 SMART
Blast:cNMP 318 429 2e-60 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Cnbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Cnbd1 APN 4 18906988 splice site probably benign
IGL01101:Cnbd1 APN 4 18907098 missense probably benign 0.30
IGL01365:Cnbd1 APN 4 18860576 missense probably damaging 1.00
IGL01646:Cnbd1 APN 4 18895141 nonsense probably null
IGL02106:Cnbd1 APN 4 18894993 missense possibly damaging 0.55
IGL02218:Cnbd1 APN 4 18887739 missense probably benign 0.00
IGL02335:Cnbd1 APN 4 19055095 missense possibly damaging 0.87
IGL02380:Cnbd1 APN 4 18887748 critical splice acceptor site probably null
IGL02380:Cnbd1 APN 4 18887749 critical splice acceptor site probably null
IGL02404:Cnbd1 APN 4 18895047 missense possibly damaging 0.64
IGL03293:Cnbd1 APN 4 18860565 missense possibly damaging 0.65
IGL03301:Cnbd1 APN 4 19055039 missense probably benign 0.00
IGL03342:Cnbd1 APN 4 19098264 splice site probably benign
IGL03392:Cnbd1 APN 4 18862111 missense probably damaging 1.00
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0062:Cnbd1 UTSW 4 18860504 missense possibly damaging 0.65
R0195:Cnbd1 UTSW 4 18906988 splice site probably benign
R0462:Cnbd1 UTSW 4 18895044 missense probably benign 0.01
R0909:Cnbd1 UTSW 4 19122444 missense probably benign
R1435:Cnbd1 UTSW 4 18907026 missense probably benign 0.00
R1995:Cnbd1 UTSW 4 19055112 missense possibly damaging 0.55
R2495:Cnbd1 UTSW 4 18860579 missense probably damaging 1.00
R3974:Cnbd1 UTSW 4 18887693 missense probably benign 0.00
R4083:Cnbd1 UTSW 4 18886042 missense possibly damaging 0.88
R4494:Cnbd1 UTSW 4 19098150 missense probably benign 0.34
R4558:Cnbd1 UTSW 4 19055095 missense possibly damaging 0.87
R4833:Cnbd1 UTSW 4 18862120 missense probably damaging 0.97
R5326:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5542:Cnbd1 UTSW 4 18860517 missense possibly damaging 0.67
R5930:Cnbd1 UTSW 4 18886119 missense probably benign 0.14
R5958:Cnbd1 UTSW 4 18862056 missense probably benign 0.31
R6064:Cnbd1 UTSW 4 18895084 missense probably benign 0.14
R6250:Cnbd1 UTSW 4 19098255 missense probably benign 0.00
R6348:Cnbd1 UTSW 4 18860462 missense probably damaging 0.99
R7027:Cnbd1 UTSW 4 18862063 missense probably benign 0.01
R7905:Cnbd1 UTSW 4 18907100 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCTCAAATATTTTAGCACGCCAAG -3'
(R):5'- GAAGTTTAAGGCATCATGGTGTATC -3'

Sequencing Primer
(F):5'- TAGCACGCCAAGTACATTTATAAGC -3'
(R):5'- TGGTGTATCTTATTCTTGGAAACAG -3'
Posted On2019-12-27