Incidental Mutation 'R7988:Hfm1'
ID615391
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene NameHFM1, ATP-dependent DNA helicase homolog
SynonymsLOC381663, A330009G12Rik, Mer3, Sec63d1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location106840192-106926321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 106898553 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 489 (L489H)
Ref Sequence ENSEMBL: ENSMUSP00000108310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495] [ENSMUST00000148686] [ENSMUST00000200249]
Predicted Effect probably damaging
Transcript: ENSMUST00000112690
AA Change: L489H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: L489H

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000117588
AA Change: L489H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: L489H

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect probably benign
Transcript: ENSMUST00000148686
Predicted Effect probably benign
Transcript: ENSMUST00000200249
SMART Domains Protein: ENSMUSP00000142727
Gene: ENSMUSG00000043410

DomainStartEndE-ValueType
Pfam:ResIII 260 410 9.9e-7 PFAM
Pfam:DEAD 281 410 1.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 intron probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4591:Hfm1 UTSW 5 106847667 missense probably benign 0.08
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 intron probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 intron probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCACACACCGTAGTTTCTGC -3'
(R):5'- CCTGAAACACTGATATTGGTAGC -3'

Sequencing Primer
(F):5'- TGCTCCACAGAGATGATAAACTTAGC -3'
(R):5'- ACTTTCAGACCATGACTTTAAAGTG -3'
Posted On2019-12-27