Incidental Mutation 'R7988:Dll3'
ID615394
Institutional Source Beutler Lab
Gene Symbol Dll3
Ensembl Gene ENSMUSG00000003436
Gene Namedelta like canonical Notch ligand 3
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.527) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location28293553-28302238 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28301535 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 32 (I32L)
Ref Sequence ENSEMBL: ENSMUSP00000103951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081946] [ENSMUST00000108315]
Predicted Effect probably benign
Transcript: ENSMUST00000081946
SMART Domains Protein: ENSMUSP00000080614
Gene: ENSMUSG00000003438

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
CPDc 146 274 1.33e-41 SMART
low complexity region 313 330 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108315
AA Change: I32L

PolyPhen 2 Score 0.610 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103951
Gene: ENSMUSG00000003436
AA Change: I32L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:EGF 60 118 3e-18 BLAST
low complexity region 140 154 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
EGF 211 247 1.53e1 SMART
EGF 275 308 3.08e-6 SMART
EGF 313 349 8.25e-7 SMART
EGF 354 387 2.83e-5 SMART
EGF 392 425 1.04e-3 SMART
EGF 430 463 7.07e-6 SMART
transmembrane domain 489 511 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the delta protein ligand family. This family functions as Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain. Mutations in this gene cause autosomal recessive spondylocostal dysostosis 1. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, a shortened body and tail, delayed and abnormal somite formation, a kinked neural tube, disorganized PNS elements, and severe axial skeletal dysplasia, including disorganized vertebrae and ribs defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Dll3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0024:Dll3 UTSW 7 28300161 splice site probably benign
R0138:Dll3 UTSW 7 28301321 missense possibly damaging 0.88
R0322:Dll3 UTSW 7 28296368 missense possibly damaging 0.88
R0479:Dll3 UTSW 7 28301549 missense probably damaging 1.00
R1711:Dll3 UTSW 7 28294497 missense probably damaging 0.98
R1742:Dll3 UTSW 7 28294423 missense probably benign 0.37
R1854:Dll3 UTSW 7 28296410 missense probably damaging 1.00
R1920:Dll3 UTSW 7 28298923 missense probably benign
R3037:Dll3 UTSW 7 28299117 missense probably damaging 0.99
R3158:Dll3 UTSW 7 28294095 missense possibly damaging 0.50
R4306:Dll3 UTSW 7 28301657 unclassified probably null
R4424:Dll3 UTSW 7 28296291 missense probably damaging 1.00
R4873:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R4875:Dll3 UTSW 7 28296435 missense probably damaging 1.00
R5604:Dll3 UTSW 7 28294632 missense probably benign
R5770:Dll3 UTSW 7 28299009 missense possibly damaging 0.84
R5988:Dll3 UTSW 7 28294112 missense probably damaging 0.98
R7204:Dll3 UTSW 7 28298905 missense possibly damaging 0.95
R7347:Dll3 UTSW 7 28299111 missense probably damaging 0.99
R7373:Dll3 UTSW 7 28294632 missense probably benign
R7694:Dll3 UTSW 7 28301745 start codon destroyed probably null 0.83
R7829:Dll3 UTSW 7 28294650 missense probably damaging 0.99
R7905:Dll3 UTSW 7 28301535 missense possibly damaging 0.61
Z1177:Dll3 UTSW 7 28301383 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGTAAAGGCTCTGGGGCAC -3'
(R):5'- TTTCCCAGACGCTGATCCTG -3'

Sequencing Primer
(F):5'- ACACGTACGAGGCCATCAGG -3'
(R):5'- AGACGCTGATCCTGGCTTTTC -3'
Posted On2019-12-27