Incidental Mutation 'R7988:Plxnb1'
ID615399
Institutional Source Beutler Lab
Gene Symbol Plxnb1
Ensembl Gene ENSMUSG00000053646
Gene Nameplexin B1
Synonyms2900002G15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location109095389-109119917 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109109232 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1285 (V1285M)
Ref Sequence ENSEMBL: ENSMUSP00000071966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072093]
Predicted Effect probably damaging
Transcript: ENSMUST00000072093
AA Change: V1285M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071966
Gene: ENSMUSG00000053646
AA Change: V1285M

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Sema 35 463 5.84e-101 SMART
PSI 481 534 1.17e-13 SMART
PSI 628 678 6.97e-3 SMART
low complexity region 691 706 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
PSI 1019 1066 2.06e-5 SMART
IPT 1067 1158 7.48e-18 SMART
IPT 1159 1247 3.97e-22 SMART
IPT 1249 1359 6.09e-9 SMART
low complexity region 1483 1494 N/A INTRINSIC
Pfam:Plexin_cytopl 1546 2086 6.5e-230 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192988
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants are viable and fertile and show no apparent defects in development, adult histology or basic functional parameters. However, a transitory renal phenotype, characterized by increased ureteric branching and enlarged kidneys, is noted over early stages of renal development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Plxnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00593:Plxnb1 APN 9 109113868 missense probably benign 0.04
IGL01014:Plxnb1 APN 9 109106034 missense probably benign 0.00
IGL01142:Plxnb1 APN 9 109102697 missense probably benign 0.05
IGL01454:Plxnb1 APN 9 109113354 missense probably damaging 1.00
IGL01469:Plxnb1 APN 9 109105415 intron probably benign
IGL01530:Plxnb1 APN 9 109110405 missense probably benign 0.02
IGL01599:Plxnb1 APN 9 109110604 missense probably damaging 1.00
IGL01968:Plxnb1 APN 9 109100984 missense probably benign 0.00
IGL02175:Plxnb1 APN 9 109100846 missense possibly damaging 0.85
IGL02216:Plxnb1 APN 9 109100850 missense probably damaging 1.00
IGL02277:Plxnb1 APN 9 109112133 missense probably damaging 1.00
IGL02311:Plxnb1 APN 9 109101122 missense probably benign
IGL02645:Plxnb1 APN 9 109114243 splice site probably benign
IGL03076:Plxnb1 APN 9 109106902 missense probably damaging 0.96
IGL03107:Plxnb1 APN 9 109104986 missense probably benign
IGL03343:Plxnb1 APN 9 109114712 missense probably damaging 1.00
PIT4431001:Plxnb1 UTSW 9 109100718 missense probably damaging 1.00
R0117:Plxnb1 UTSW 9 109105218 missense possibly damaging 0.93
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0211:Plxnb1 UTSW 9 109103663 nonsense probably null
R0843:Plxnb1 UTSW 9 109113701 missense probably benign 0.20
R0970:Plxnb1 UTSW 9 109103263 missense probably damaging 1.00
R0973:Plxnb1 UTSW 9 109102142 missense possibly damaging 0.47
R1342:Plxnb1 UTSW 9 109100652 missense possibly damaging 0.87
R1386:Plxnb1 UTSW 9 109101023 missense probably benign 0.27
R1419:Plxnb1 UTSW 9 109114386 missense probably damaging 1.00
R1445:Plxnb1 UTSW 9 109108921 missense probably null
R1548:Plxnb1 UTSW 9 109100900 missense possibly damaging 0.95
R1621:Plxnb1 UTSW 9 109106805 missense probably benign 0.04
R1658:Plxnb1 UTSW 9 109102871 nonsense probably null
R1727:Plxnb1 UTSW 9 109101057 unclassified probably null
R1750:Plxnb1 UTSW 9 109111768 missense probably benign 0.00
R1795:Plxnb1 UTSW 9 109100745 missense probably benign
R1929:Plxnb1 UTSW 9 109102708 splice site probably null
R1935:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R1936:Plxnb1 UTSW 9 109095647 critical splice donor site probably null
R2014:Plxnb1 UTSW 9 109106619 splice site probably benign
R2057:Plxnb1 UTSW 9 109109226 missense possibly damaging 0.71
R2102:Plxnb1 UTSW 9 109115742 missense probably damaging 1.00
R2271:Plxnb1 UTSW 9 109102708 splice site probably null
R2422:Plxnb1 UTSW 9 109108438 missense probably benign 0.02
R2881:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R3409:Plxnb1 UTSW 9 109106613 splice site probably null
R3417:Plxnb1 UTSW 9 109100760 missense probably damaging 0.97
R3756:Plxnb1 UTSW 9 109113458 unclassified probably benign
R3788:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R3789:Plxnb1 UTSW 9 109109287 missense possibly damaging 0.89
R4042:Plxnb1 UTSW 9 109105173 missense probably benign 0.00
R4289:Plxnb1 UTSW 9 109114352 missense probably damaging 1.00
R4396:Plxnb1 UTSW 9 109100223 missense possibly damaging 0.51
R4564:Plxnb1 UTSW 9 109113420 missense probably benign 0.10
R4676:Plxnb1 UTSW 9 109110435 missense possibly damaging 0.63
R4706:Plxnb1 UTSW 9 109112028 missense probably damaging 1.00
R4792:Plxnb1 UTSW 9 109110648 missense probably damaging 1.00
R4796:Plxnb1 UTSW 9 109114595 missense probably damaging 1.00
R4835:Plxnb1 UTSW 9 109105374 missense probably damaging 0.96
R4901:Plxnb1 UTSW 9 109104959 missense probably benign 0.01
R4952:Plxnb1 UTSW 9 109114836 missense probably damaging 1.00
R5005:Plxnb1 UTSW 9 109106579 missense probably benign 0.00
R5015:Plxnb1 UTSW 9 109100430 missense possibly damaging 0.95
R5029:Plxnb1 UTSW 9 109114655 missense probably damaging 1.00
R5180:Plxnb1 UTSW 9 109111693 unclassified probably null
R5256:Plxnb1 UTSW 9 109114593 missense probably damaging 1.00
R5285:Plxnb1 UTSW 9 109108459 missense probably damaging 0.99
R5431:Plxnb1 UTSW 9 109100772 missense probably damaging 1.00
R5444:Plxnb1 UTSW 9 109106453 missense probably benign 0.22
R5546:Plxnb1 UTSW 9 109100750 missense probably damaging 1.00
R5852:Plxnb1 UTSW 9 109106450 missense probably damaging 1.00
R5892:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6020:Plxnb1 UTSW 9 109116611 missense probably damaging 1.00
R6053:Plxnb1 UTSW 9 109111707 missense probably damaging 1.00
R6177:Plxnb1 UTSW 9 109102925 unclassified probably null
R6193:Plxnb1 UTSW 9 109104903 missense probably benign
R6274:Plxnb1 UTSW 9 109112141 critical splice donor site probably null
R6310:Plxnb1 UTSW 9 109109728 missense probably damaging 0.96
R6404:Plxnb1 UTSW 9 109116637 missense probably damaging 1.00
R6422:Plxnb1 UTSW 9 109108924 missense probably damaging 1.00
R6479:Plxnb1 UTSW 9 109111665 missense possibly damaging 0.92
R6555:Plxnb1 UTSW 9 109108405 critical splice acceptor site probably null
R6646:Plxnb1 UTSW 9 109108827 missense probably benign
R6648:Plxnb1 UTSW 9 109104330 missense probably benign 0.14
R6661:Plxnb1 UTSW 9 109104299 missense possibly damaging 0.94
R6674:Plxnb1 UTSW 9 109108146 missense probably benign 0.00
R6734:Plxnb1 UTSW 9 109108920 nonsense probably null
R6859:Plxnb1 UTSW 9 109106770 missense probably damaging 1.00
R6948:Plxnb1 UTSW 9 109116634 missense probably damaging 0.96
R7030:Plxnb1 UTSW 9 109112307 missense probably damaging 1.00
R7038:Plxnb1 UTSW 9 109100385 missense probably damaging 1.00
R7204:Plxnb1 UTSW 9 109100175 missense probably damaging 1.00
R7427:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7428:Plxnb1 UTSW 9 109108168 missense probably benign 0.01
R7443:Plxnb1 UTSW 9 109114607 missense probably damaging 1.00
R7527:Plxnb1 UTSW 9 109100861 missense probably damaging 0.99
R7645:Plxnb1 UTSW 9 109114412 missense probably damaging 1.00
R7680:Plxnb1 UTSW 9 109100503 nonsense probably null
R7866:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7898:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
R7905:Plxnb1 UTSW 9 109109232 missense probably damaging 1.00
R7949:Plxnb1 UTSW 9 109100457 missense probably damaging 0.98
R7981:Plxnb1 UTSW 9 109114340 missense probably damaging 1.00
Z1177:Plxnb1 UTSW 9 109108921 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GTTCTCACAATAGGGGAGGTGG -3'
(R):5'- AGCATCTCCTTTGGCACCAAC -3'

Sequencing Primer
(F):5'- TGGGAACTGTGAACTCCTTAC -3'
(R):5'- TTTGGCACCAACTCCCCGG -3'
Posted On2019-12-27