Incidental Mutation 'R7988:Nek9'
ID615408
Institutional Source Beutler Lab
Gene Symbol Nek9
Ensembl Gene ENSMUSG00000034290
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 9
SynonymsC130021H08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location85299514-85339362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 85305596 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 831 (M831R)
Ref Sequence ENSEMBL: ENSMUSP00000049056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040992]
Predicted Effect probably damaging
Transcript: ENSMUST00000040992
AA Change: M831R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000049056
Gene: ENSMUSG00000034290
AA Change: M831R

DomainStartEndE-ValueType
low complexity region 19 49 N/A INTRINSIC
S_TKc 52 308 1.07e-73 SMART
Pfam:RCC1 389 441 1.2e-9 PFAM
Pfam:RCC1_2 428 457 1.5e-8 PFAM
Pfam:RCC1 444 495 3.6e-13 PFAM
Pfam:RCC1_2 482 511 3.6e-11 PFAM
Pfam:RCC1 499 547 7.6e-14 PFAM
Pfam:RCC1 615 665 4.2e-8 PFAM
Pfam:RCC1_2 652 681 4.4e-7 PFAM
low complexity region 752 767 N/A INTRINSIC
low complexity region 889 900 N/A INTRINSIC
low complexity region 910 927 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NimA (never in mitosis A) family of serine/threonine protein kinases. The encoded protein is activated in mitosis and, in turn, activates other family members during mitosis. This protein also mediates cellular processes that are essential for interphase progression. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Nek9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01431:Nek9 APN 12 85314587 missense probably benign 0.23
IGL01595:Nek9 APN 12 85314420 missense probably damaging 1.00
IGL01603:Nek9 APN 12 85305605 missense probably damaging 1.00
IGL01893:Nek9 APN 12 85336400 missense probably damaging 1.00
IGL02017:Nek9 APN 12 85329923 missense probably damaging 1.00
IGL02197:Nek9 APN 12 85307930 missense probably null
IGL02207:Nek9 APN 12 85303483 nonsense probably null
IGL02749:Nek9 APN 12 85305507 missense probably benign 0.02
IGL02756:Nek9 APN 12 85311336 critical splice donor site probably null
IGL03343:Nek9 APN 12 85303609 missense probably damaging 1.00
Rose_colored UTSW 12 85303537 missense probably damaging 1.00
R0048:Nek9 UTSW 12 85301899 missense probably benign 0.17
R0331:Nek9 UTSW 12 85327375 splice site probably benign
R0499:Nek9 UTSW 12 85301883 missense probably benign 0.09
R1484:Nek9 UTSW 12 85301848 missense probably damaging 1.00
R1760:Nek9 UTSW 12 85305590 missense possibly damaging 0.71
R1760:Nek9 UTSW 12 85310410 missense probably benign 0.00
R1883:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1884:Nek9 UTSW 12 85332556 missense probably damaging 1.00
R1999:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2046:Nek9 UTSW 12 85320707 splice site probably benign
R2096:Nek9 UTSW 12 85314548 missense probably benign 0.00
R2150:Nek9 UTSW 12 85329903 missense probably damaging 1.00
R2368:Nek9 UTSW 12 85329887 missense possibly damaging 0.89
R2570:Nek9 UTSW 12 85332546 nonsense probably null
R4381:Nek9 UTSW 12 85329858 missense probably damaging 1.00
R4570:Nek9 UTSW 12 85320734 missense probably damaging 1.00
R4661:Nek9 UTSW 12 85320892 missense possibly damaging 0.78
R4669:Nek9 UTSW 12 85314204 missense probably benign 0.00
R4993:Nek9 UTSW 12 85310420 missense probably damaging 1.00
R5071:Nek9 UTSW 12 85327459 missense possibly damaging 0.70
R5090:Nek9 UTSW 12 85329842 critical splice donor site probably null
R5248:Nek9 UTSW 12 85308977 missense probably damaging 1.00
R5521:Nek9 UTSW 12 85327445 missense probably benign 0.09
R5734:Nek9 UTSW 12 85303515 missense probably benign
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6039:Nek9 UTSW 12 85313085 missense probably benign 0.08
R6269:Nek9 UTSW 12 85332329 intron probably null
R6353:Nek9 UTSW 12 85301829 missense probably damaging 0.96
R6406:Nek9 UTSW 12 85339172 missense probably damaging 0.97
R6744:Nek9 UTSW 12 85329929 missense probably benign 0.09
R6922:Nek9 UTSW 12 85303537 missense probably damaging 1.00
R7603:Nek9 UTSW 12 85303514 missense probably benign 0.00
R7686:Nek9 UTSW 12 85303659 missense probably benign 0.01
R7905:Nek9 UTSW 12 85305596 missense probably damaging 1.00
X0052:Nek9 UTSW 12 85322027 critical splice donor site probably null
Z1177:Nek9 UTSW 12 85334045 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACCCTCTTGTGCTGGAAG -3'
(R):5'- GTTAGGCAATATATGTGGTCAGCC -3'

Sequencing Primer
(F):5'- AACTGCCAGGACAGTGC -3'
(R):5'- CACCATTCTGTACCACTAGAGGG -3'
Posted On2019-12-27