Incidental Mutation 'R7988:Dirc2'
ID615412
Institutional Source Beutler Lab
Gene Symbol Dirc2
Ensembl Gene ENSMUSG00000022848
Gene Namedisrupted in renal carcinoma 2 (human)
SynonymsRCC4
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35694062-35769356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35768950 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 98 (P98S)
Ref Sequence ENSEMBL: ENSMUSP00000023554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023554] [ENSMUST00000023555] [ENSMUST00000149892] [ENSMUST00000231579]
Predicted Effect probably benign
Transcript: ENSMUST00000023554
AA Change: P98S

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023554
Gene: ENSMUSG00000022848
AA Change: P98S

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 111 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
transmembrane domain 148 170 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 231 250 N/A INTRINSIC
low complexity region 251 258 N/A INTRINSIC
transmembrane domain 280 302 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 344 366 N/A INTRINSIC
transmembrane domain 381 403 N/A INTRINSIC
transmembrane domain 415 437 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023555
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149892
AA Change: P98S

PolyPhen 2 Score 0.327 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000120775
Gene: ENSMUSG00000022848
AA Change: P98S

DomainStartEndE-ValueType
low complexity region 8 33 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
transmembrane domain 90 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231579
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-bound protein from the major facilitator superfamily of transporters. Disruption of this gene by translocation has been associated with haplo-insufficiency and renal cell carcinomas. Alternatively spliced transcript variants have been described, but their biological validity has not yet been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Dirc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Dirc2 APN 16 35735558 missense probably benign 0.01
IGL02990:Dirc2 APN 16 35735491 missense possibly damaging 0.68
R0166:Dirc2 UTSW 16 35719314 missense possibly damaging 0.49
R0319:Dirc2 UTSW 16 35750514 missense probably benign 0.01
R0323:Dirc2 UTSW 16 35719360 frame shift probably null
R0497:Dirc2 UTSW 16 35735604 missense probably benign 0.40
R1240:Dirc2 UTSW 16 35698009 missense probably benign 0.00
R1460:Dirc2 UTSW 16 35719366 missense probably benign 0.25
R2115:Dirc2 UTSW 16 35697939 missense probably benign 0.17
R4502:Dirc2 UTSW 16 35719417 missense probably benign 0.00
R4503:Dirc2 UTSW 16 35719417 missense probably benign 0.00
R4563:Dirc2 UTSW 16 35697942 missense probably damaging 1.00
R4834:Dirc2 UTSW 16 35735575 missense probably benign 0.08
R5278:Dirc2 UTSW 16 35697988 missense probably damaging 1.00
R5651:Dirc2 UTSW 16 35735616 missense probably benign 0.25
R5717:Dirc2 UTSW 16 35719429 missense probably benign 0.00
R5947:Dirc2 UTSW 16 35730306 missense probably benign 0.14
R6176:Dirc2 UTSW 16 35704797 missense probably benign
R7155:Dirc2 UTSW 16 35735577 missense probably benign 0.02
R7450:Dirc2 UTSW 16 35768974 missense possibly damaging 0.76
R7645:Dirc2 UTSW 16 35734068 critical splice acceptor site probably null
R7905:Dirc2 UTSW 16 35768950 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGGAATGGGATGCCAGCTAC -3'
(R):5'- TACCCTTTCCACTCGTAGGG -3'

Sequencing Primer
(F):5'- AGCTACACTGGGTCACCTC -3'
(R):5'- AGGACTAGAGCAGCTCCG -3'
Posted On2019-12-27