Incidental Mutation 'R7988:Actl9'
ID615415
Institutional Source Beutler Lab
Gene Symbol Actl9
Ensembl Gene ENSMUSG00000092519
Gene Nameactin-like 9
Synonyms1700029I08Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location33432896-33434268 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33433827 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 287 (V287A)
Ref Sequence ENSEMBL: ENSMUSP00000134564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000174088]
Predicted Effect possibly damaging
Transcript: ENSMUST00000174088
AA Change: V287A

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134564
Gene: ENSMUSG00000092519
AA Change: V287A

DomainStartEndE-ValueType
ACTIN 48 415 6.36e-112 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Dsg4 A T 18: 20,454,669 I278F probably damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Actl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Actl9 APN 17 33434178 missense probably damaging 1.00
IGL01990:Actl9 APN 17 33434094 missense probably benign 0.09
IGL02691:Actl9 APN 17 33433118 missense probably damaging 0.99
IGL02930:Actl9 APN 17 33434099 missense probably damaging 1.00
nerva UTSW 17 33433122 missense probably damaging 1.00
PIT4486001:Actl9 UTSW 17 33434198 missense possibly damaging 0.95
R0523:Actl9 UTSW 17 33433349 missense probably damaging 1.00
R0606:Actl9 UTSW 17 33433598 missense probably damaging 1.00
R1545:Actl9 UTSW 17 33433257 missense probably damaging 1.00
R1732:Actl9 UTSW 17 33433122 missense probably damaging 1.00
R3958:Actl9 UTSW 17 33433764 missense probably benign 0.09
R4701:Actl9 UTSW 17 33433935 missense probably benign 0.26
R4943:Actl9 UTSW 17 33433085 missense possibly damaging 0.95
R4971:Actl9 UTSW 17 33433908 missense probably damaging 1.00
R5032:Actl9 UTSW 17 33434088 missense probably benign 0.04
R5236:Actl9 UTSW 17 33434099 missense probably damaging 1.00
R5782:Actl9 UTSW 17 33433761 missense probably benign 0.00
R6127:Actl9 UTSW 17 33433380 missense probably benign 0.03
R6808:Actl9 UTSW 17 33433124 missense probably damaging 1.00
R6899:Actl9 UTSW 17 33433559 missense probably damaging 1.00
R7657:Actl9 UTSW 17 33433040 missense probably benign 0.04
R7663:Actl9 UTSW 17 33433469 missense probably damaging 1.00
R7905:Actl9 UTSW 17 33433827 missense possibly damaging 0.92
X0062:Actl9 UTSW 17 33433128 missense probably damaging 1.00
Z1176:Actl9 UTSW 17 33433101 missense possibly damaging 0.95
Z1177:Actl9 UTSW 17 33433113 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTTACAACCTACCCCATGC -3'
(R):5'- GAGCCTCCGCATAGTATCAC -3'

Sequencing Primer
(F):5'- TGGCAGGAAACCATCTTACTG -3'
(R):5'- GCATAGTATCACATTCCGGGC -3'
Posted On2019-12-27