Incidental Mutation 'R7988:Dsg4'
ID615417
Institutional Source Beutler Lab
Gene Symbol Dsg4
Ensembl Gene ENSMUSG00000001804
Gene Namedesmoglein 4
Synonymslah, CDHF13
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.607) question?
Stock #R7988 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20436175-20471821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 20454669 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 278 (I278F)
Ref Sequence ENSEMBL: ENSMUSP00000019426 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019426]
Predicted Effect probably damaging
Transcript: ENSMUST00000019426
AA Change: I278F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019426
Gene: ENSMUSG00000001804
AA Change: I278F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
CA 70 155 1.54e-11 SMART
CA 179 267 4.27e-19 SMART
CA 290 384 5.48e-8 SMART
CA 411 495 9.4e-7 SMART
transmembrane domain 634 656 N/A INTRINSIC
low complexity region 724 736 N/A INTRINSIC
Pfam:Cadherin_C 749 849 3.1e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. This gene is expressed in the suprabasal epidermis and hair follicle. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the lanceolate hair phenotype in mice. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice carrying mutations at this locus exhibit abnormalities in hair growth, vibrissae growth, and a thickened epidermis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A G 10: 82,296,102 I358T probably benign Het
Actl9 T C 17: 33,433,827 V287A possibly damaging Het
Adcy10 T A 1: 165,513,168 probably null Het
Aox1 G A 1: 58,104,398 S1225N possibly damaging Het
B430306N03Rik T A 17: 48,316,960 S96R probably benign Het
Bpifa5 T C 2: 154,165,588 I150T probably damaging Het
Ccdc28a A T 10: 18,218,328 V181D probably benign Het
Cd40 T C 2: 165,062,325 Y31H probably damaging Het
Cep290 A G 10: 100,554,490 T2032A probably benign Het
Cnbd1 T C 4: 18,907,100 K158R possibly damaging Het
Degs1 A C 1: 182,279,036 N255K possibly damaging Het
Dirc2 G A 16: 35,768,950 P98S probably benign Het
Dll3 T G 7: 28,301,535 I32L possibly damaging Het
Ets2 T A 16: 95,706,437 I6N probably damaging Het
Gbp4 A G 5: 105,121,087 F400S probably damaging Het
Golgb1 C T 16: 36,913,685 A1139V probably benign Het
Hfm1 A T 5: 106,898,553 L489H probably damaging Het
Kcna5 T C 6: 126,534,868 D99G probably benign Het
Mief1 C G 15: 80,249,398 P219A probably damaging Het
Myh11 A T 16: 14,207,681 Y1408* probably null Het
Myo1b A G 1: 51,763,884 probably null Het
Nedd4 A T 9: 72,677,379 K121* probably null Het
Nek9 A C 12: 85,305,596 M831R probably damaging Het
Nf1 G A 11: 79,547,112 A83T possibly damaging Het
Olfr772 A T 10: 129,174,187 I278N probably damaging Het
Osbpl10 T C 9: 115,062,010 probably null Het
Pcdhb6 T C 18: 37,334,554 L176P probably benign Het
Plxnb1 G A 9: 109,109,232 V1285M probably damaging Het
Psg26 T A 7: 18,475,317 M389L probably benign Het
Slc4a10 A G 2: 62,268,151 E543G probably damaging Het
Spink7 G T 18: 62,592,416 C85* probably null Het
Stard9 T C 2: 120,696,081 W940R not run Het
Susd2 A T 10: 75,639,657 L471* probably null Het
Taf2 A T 15: 55,047,432 D615E possibly damaging Het
Tfdp2 T C 9: 96,310,606 S14P Het
Tha1 A C 11: 117,871,067 V116G possibly damaging Het
Trim46 T C 3: 89,244,326 H50R probably damaging Het
Trit1 A G 4: 123,016,715 K36E probably damaging Het
Ttc13 A T 8: 124,688,596 M268K probably benign Het
Ufc1 T A 1: 171,289,935 K68N probably damaging Het
Zbbx T C 3: 75,085,513 T225A probably benign Het
Zfp768 T C 7: 127,344,659 E102G probably damaging Het
Other mutations in Dsg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Dsg4 APN 18 20461326 missense probably benign 0.22
IGL01723:Dsg4 APN 18 20466510 missense probably damaging 1.00
IGL02249:Dsg4 APN 18 20461304 missense possibly damaging 0.69
IGL02445:Dsg4 APN 18 20446250 splice site probably benign
IGL02553:Dsg4 APN 18 20462520 missense probably benign
IGL02578:Dsg4 APN 18 20471193 missense possibly damaging 0.94
IGL02634:Dsg4 APN 18 20458580 missense probably benign 0.01
IGL02677:Dsg4 APN 18 20464876 missense possibly damaging 0.62
IGL02741:Dsg4 APN 18 20471496 missense probably benign
IGL02747:Dsg4 APN 18 20446938 missense probably damaging 0.97
IGL03342:Dsg4 APN 18 20451823 missense probably damaging 1.00
burrito UTSW 18 20451862 missense possibly damaging 0.81
R0043:Dsg4 UTSW 18 20452972 missense probably damaging 1.00
R0375:Dsg4 UTSW 18 20470879 missense probably damaging 1.00
R0537:Dsg4 UTSW 18 20458571 missense probably damaging 1.00
R0619:Dsg4 UTSW 18 20461359 missense probably benign 0.00
R0622:Dsg4 UTSW 18 20449788 missense possibly damaging 0.51
R0765:Dsg4 UTSW 18 20454646 splice site probably benign
R0786:Dsg4 UTSW 18 20449372 critical splice donor site probably null
R1114:Dsg4 UTSW 18 20466483 missense possibly damaging 0.62
R1249:Dsg4 UTSW 18 20446872 nonsense probably null
R1372:Dsg4 UTSW 18 20449676 splice site probably null
R1382:Dsg4 UTSW 18 20465124 missense probably benign 0.00
R1392:Dsg4 UTSW 18 20446247 splice site probably benign
R1442:Dsg4 UTSW 18 20462660 missense possibly damaging 0.76
R1503:Dsg4 UTSW 18 20449679 missense probably damaging 1.00
R1704:Dsg4 UTSW 18 20471589 missense probably damaging 1.00
R1716:Dsg4 UTSW 18 20462461 nonsense probably null
R1765:Dsg4 UTSW 18 20456831 missense probably benign 0.01
R1817:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R1982:Dsg4 UTSW 18 20471212 missense probably damaging 1.00
R2025:Dsg4 UTSW 18 20466636 nonsense probably null
R2097:Dsg4 UTSW 18 20471044 missense probably damaging 1.00
R2198:Dsg4 UTSW 18 20461442 missense probably benign
R3551:Dsg4 UTSW 18 20451756 missense probably damaging 1.00
R3742:Dsg4 UTSW 18 20471001 missense probably damaging 1.00
R3853:Dsg4 UTSW 18 20449234 missense probably benign
R3955:Dsg4 UTSW 18 20449375 splice site probably null
R4006:Dsg4 UTSW 18 20470965 missense probably damaging 0.97
R4012:Dsg4 UTSW 18 20451862 missense possibly damaging 0.81
R4171:Dsg4 UTSW 18 20458579 nonsense probably null
R4254:Dsg4 UTSW 18 20471538 missense probably benign 0.07
R4504:Dsg4 UTSW 18 20461436 missense probably benign 0.00
R4559:Dsg4 UTSW 18 20470921 missense probably damaging 1.00
R4607:Dsg4 UTSW 18 20471245 missense probably damaging 1.00
R4612:Dsg4 UTSW 18 20462413 missense probably benign 0.10
R4683:Dsg4 UTSW 18 20461409 missense probably benign
R4700:Dsg4 UTSW 18 20456908 missense possibly damaging 0.91
R4749:Dsg4 UTSW 18 20446831 missense possibly damaging 0.88
R4775:Dsg4 UTSW 18 20471127 missense possibly damaging 0.48
R4809:Dsg4 UTSW 18 20466621 missense possibly damaging 0.82
R5276:Dsg4 UTSW 18 20446839 missense probably benign 0.21
R5426:Dsg4 UTSW 18 20458484 missense probably damaging 1.00
R5767:Dsg4 UTSW 18 20462492 nonsense probably null
R5982:Dsg4 UTSW 18 20465169 missense possibly damaging 0.76
R6280:Dsg4 UTSW 18 20466667 missense probably damaging 1.00
R6305:Dsg4 UTSW 18 20449790 missense probably damaging 1.00
R6489:Dsg4 UTSW 18 20471363 missense possibly damaging 0.93
R7013:Dsg4 UTSW 18 20458521 missense possibly damaging 0.58
R7040:Dsg4 UTSW 18 20451852 missense probably benign 0.01
R7196:Dsg4 UTSW 18 20466480 missense probably damaging 1.00
R7432:Dsg4 UTSW 18 20446266 nonsense probably null
R7438:Dsg4 UTSW 18 20466628 missense probably damaging 0.96
R7490:Dsg4 UTSW 18 20451936 intron probably null
R7612:Dsg4 UTSW 18 20470990 missense probably damaging 1.00
R7639:Dsg4 UTSW 18 20449712 missense probably damaging 1.00
R7905:Dsg4 UTSW 18 20454669 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGCCCACAAAGTCCAATG -3'
(R):5'- ACCTTGACCACTTTCAAAATGC -3'

Sequencing Primer
(F):5'- GTGGCCCACAAAGTCCAATGTTTAC -3'
(R):5'- GACCACTTTCAAAATGCCTTCATTGG -3'
Posted On2019-12-27