Incidental Mutation 'R7989:Zdbf2'
ID615421
Institutional Source Beutler Lab
Gene Symbol Zdbf2
Ensembl Gene ENSMUSG00000027520
Gene Namezinc finger, DBF-type containing 2
Synonyms4930431J08Rik, 9330107J05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R7989 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location63273265-63314576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63306827 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1455 (I1455T)
Ref Sequence ENSEMBL: ENSMUSP00000029025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029025] [ENSMUST00000114132]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029025
AA Change: I1455T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029025
Gene: ENSMUSG00000027520
AA Change: I1455T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114132
AA Change: I1455T

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000109767
Gene: ENSMUSG00000027520
AA Change: I1455T

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
low complexity region 150 164 N/A INTRINSIC
low complexity region 378 405 N/A INTRINSIC
internal_repeat_6 407 565 7.68e-5 PROSPERO
internal_repeat_5 418 768 5.53e-5 PROSPERO
internal_repeat_1 618 873 3.17e-15 PROSPERO
internal_repeat_4 621 885 2.09e-6 PROSPERO
internal_repeat_3 642 886 1.52e-7 PROSPERO
internal_repeat_2 650 912 5.87e-11 PROSPERO
internal_repeat_6 722 891 7.68e-5 PROSPERO
low complexity region 965 982 N/A INTRINSIC
internal_repeat_4 1061 1328 2.09e-6 PROSPERO
internal_repeat_2 1215 1484 5.87e-11 PROSPERO
internal_repeat_3 1287 1507 1.52e-7 PROSPERO
internal_repeat_1 1307 1536 3.17e-15 PROSPERO
internal_repeat_5 1388 1758 5.53e-5 PROSPERO
low complexity region 1767 1778 N/A INTRINSIC
low complexity region 2211 2235 N/A INTRINSIC
low complexity region 2240 2399 N/A INTRINSIC
low complexity region 2402 2420 N/A INTRINSIC
low complexity region 2446 2458 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing DBF4-type zinc finger domains. This gene is imprinted and paternally expressed in lymphocytes but is more stochastically expressed in the placenta. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,379,465 K533N possibly damaging Het
1110032A03Rik T A 9: 50,763,948 T153S possibly damaging Het
9530053A07Rik A T 7: 28,147,496 Y1168F probably benign Het
A4galt A G 15: 83,228,376 F69L probably benign Het
Acsf3 A G 8: 122,785,823 M328V probably damaging Het
Adam10 T G 9: 70,761,764 V454G possibly damaging Het
Adamts15 T C 9: 30,902,226 D881G probably benign Het
Adamtsl1 T C 4: 86,356,439 V1244A probably benign Het
Ankfn1 G A 11: 89,405,534 P123L probably damaging Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Arntl A T 7: 113,313,473 I579L probably benign Het
Btnl4 A G 17: 34,473,187 M147T possibly damaging Het
Camk1g T C 1: 193,359,774 K56E probably damaging Het
Capn7 T C 14: 31,366,245 probably null Het
Cbln1 T A 8: 87,472,096 T49S probably benign Het
Cc2d2a T C 5: 43,706,846 V763A probably benign Het
Cdc40 A G 10: 40,848,046 Y249H probably damaging Het
Cfap61 T A 2: 146,102,099 L762H probably damaging Het
Cfap73 T C 5: 120,630,058 T212A probably benign Het
Cfi A G 3: 129,848,584 E29G probably benign Het
Clec14a T C 12: 58,267,679 T386A possibly damaging Het
Coq6 T A 12: 84,371,166 L268H probably damaging Het
Cpt1a T C 19: 3,362,202 S225P probably benign Het
Cyc1 C A 15: 76,343,591 probably null Het
Dhx58 C A 11: 100,695,304 L630F probably damaging Het
Dlg2 T A 7: 91,900,773 V158E probably damaging Het
Foxd3 A G 4: 99,657,339 T239A probably benign Het
Galnt6 T C 15: 100,703,361 T346A probably damaging Het
Gm10234 A G 6: 95,322,160 probably null Het
Guca1b C G 17: 47,391,177 T185S unknown Het
H2-M5 T C 17: 36,987,679 T292A probably benign Het
Hlx T C 1: 184,727,576 H455R probably benign Het
Hydin A G 8: 110,510,867 Y1924C probably benign Het
Ighg2b C T 12: 113,306,454 V315M Het
Ildr2 A G 1: 166,307,800 K374E probably damaging Het
Jmjd1c T C 10: 67,225,842 S1144P probably benign Het
Kcnj8 T C 6: 142,566,029 D284G probably benign Het
Lingo4 A G 3: 94,402,234 T160A probably benign Het
Lmod3 G T 6: 97,248,473 A129E probably benign Het
Lrrk2 T C 15: 91,726,152 C696R probably damaging Het
Mc2r A G 18: 68,407,965 F86L probably benign Het
Mfsd7a T C 5: 108,444,497 I276V probably benign Het
Mppe1 T G 18: 67,228,984 K170T probably benign Het
Mtcl1 A G 17: 66,371,330 I667T possibly damaging Het
Mtnr1a A T 8: 45,087,826 I275F probably benign Het
Myh2 A G 11: 67,197,371 I1938V probably benign Het
Npsr1 A T 9: 24,289,800 E160V probably damaging Het
Olfr156 T A 4: 43,821,086 I92F probably damaging Het
Olfr788 T A 10: 129,472,998 I102N probably damaging Het
Ovch2 T A 7: 107,789,119 Y418F probably damaging Het
Pak7 A G 2: 136,116,559 L203S probably benign Het
Pcdh15 A T 10: 74,643,582 E508D probably benign Het
Prl7a1 T C 13: 27,642,450 M1V probably null Het
Prpsap2 G T 11: 61,756,272 N14K possibly damaging Het
Rad54b T A 4: 11,595,868 V215E probably null Het
Ryr2 G A 13: 11,792,748 T845I probably benign Het
Scgb2b3 G A 7: 31,362,014 T20I probably damaging Het
Serpina1b T C 12: 103,728,307 I393V possibly damaging Het
Slc13a5 T C 11: 72,259,064 M207V probably benign Het
Smg1 A T 7: 118,186,134 L843M unknown Het
Sp100 T C 1: 85,708,067 V531A possibly damaging Het
Srsf6 T C 2: 162,933,840 S190P unknown Het
Stil A G 4: 115,032,699 K795E possibly damaging Het
Sugp2 A G 8: 70,251,927 R705G probably benign Het
Tnfrsf11a T A 1: 105,809,374 C69S probably damaging Het
Trim30a A T 7: 104,421,449 N252K probably benign Het
Tshz1 T A 18: 84,014,607 K559* probably null Het
Ttbk1 C T 17: 46,478,938 R133H probably damaging Het
Unc79 T A 12: 103,063,089 probably null Het
Vmn1r1 T C 1: 182,157,350 Y250C probably benign Het
Vmn2r12 A G 5: 109,086,441 L635P probably damaging Het
Vwa5b1 A T 4: 138,569,170 L1182* probably null Het
Washc2 A G 6: 116,248,145 D818G probably benign Het
Xylb T G 9: 119,381,545 S365A probably benign Het
Zcchc8 T C 5: 123,720,720 probably benign Het
Other mutations in Zdbf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Zdbf2 APN 1 63306514 missense possibly damaging 0.92
IGL00796:Zdbf2 APN 1 63307205 missense probably benign 0.04
IGL00801:Zdbf2 APN 1 63303038 missense possibly damaging 0.66
IGL02803:Zdbf2 APN 1 63303077 missense possibly damaging 0.46
R0143:Zdbf2 UTSW 1 63308074 missense probably benign 0.01
R0147:Zdbf2 UTSW 1 63304006 nonsense probably null
R0148:Zdbf2 UTSW 1 63304006 nonsense probably null
R0433:Zdbf2 UTSW 1 63306143 missense possibly damaging 0.46
R0502:Zdbf2 UTSW 1 63305290 missense possibly damaging 0.66
R0645:Zdbf2 UTSW 1 63304950 missense possibly damaging 0.81
R0765:Zdbf2 UTSW 1 63305723 missense possibly damaging 0.46
R1068:Zdbf2 UTSW 1 63303430 missense possibly damaging 0.94
R1216:Zdbf2 UTSW 1 63303002 missense possibly damaging 0.83
R1235:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R1352:Zdbf2 UTSW 1 63303053 missense probably damaging 0.96
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1402:Zdbf2 UTSW 1 63303627 missense possibly damaging 0.46
R1435:Zdbf2 UTSW 1 63303040 missense possibly damaging 0.66
R1562:Zdbf2 UTSW 1 63303588 missense possibly damaging 0.83
R1624:Zdbf2 UTSW 1 63303859 missense possibly damaging 0.66
R1635:Zdbf2 UTSW 1 63304334 missense possibly damaging 0.92
R1644:Zdbf2 UTSW 1 63308972 missense possibly damaging 0.66
R1662:Zdbf2 UTSW 1 63304249 nonsense probably null
R1700:Zdbf2 UTSW 1 63302741 missense unknown
R1720:Zdbf2 UTSW 1 63303277 missense possibly damaging 0.46
R1853:Zdbf2 UTSW 1 63305542 frame shift probably null
R1854:Zdbf2 UTSW 1 63305542 frame shift probably null
R1973:Zdbf2 UTSW 1 63309701 missense unknown
R2336:Zdbf2 UTSW 1 63303464 missense probably benign 0.00
R2428:Zdbf2 UTSW 1 63305615 missense probably benign 0.04
R3010:Zdbf2 UTSW 1 63303065 missense possibly damaging 0.92
R3034:Zdbf2 UTSW 1 63304205 missense probably damaging 0.96
R3079:Zdbf2 UTSW 1 63307477 missense probably benign 0.05
R3196:Zdbf2 UTSW 1 63308420 missense possibly damaging 0.46
R3711:Zdbf2 UTSW 1 63308671 missense possibly damaging 0.83
R3845:Zdbf2 UTSW 1 63308324 missense possibly damaging 0.66
R4093:Zdbf2 UTSW 1 63309781 missense possibly damaging 0.83
R4250:Zdbf2 UTSW 1 63302861 missense possibly damaging 0.46
R4592:Zdbf2 UTSW 1 63306591 missense possibly damaging 0.82
R4721:Zdbf2 UTSW 1 63308792 missense possibly damaging 0.46
R4779:Zdbf2 UTSW 1 63303238 missense possibly damaging 0.66
R4928:Zdbf2 UTSW 1 63308814 missense possibly damaging 0.81
R4943:Zdbf2 UTSW 1 63302914 missense possibly damaging 0.92
R5025:Zdbf2 UTSW 1 63303650 missense possibly damaging 0.82
R5095:Zdbf2 UTSW 1 63309073 missense possibly damaging 0.66
R5149:Zdbf2 UTSW 1 63304903 missense possibly damaging 0.83
R5326:Zdbf2 UTSW 1 63304411 missense possibly damaging 0.66
R5341:Zdbf2 UTSW 1 63307933 missense probably benign 0.27
R5511:Zdbf2 UTSW 1 63305677 missense probably benign 0.03
R5809:Zdbf2 UTSW 1 63305876 missense possibly damaging 0.90
R5902:Zdbf2 UTSW 1 63306526 missense possibly damaging 0.83
R6162:Zdbf2 UTSW 1 63280818 start gained probably benign
R6245:Zdbf2 UTSW 1 63304433 missense possibly damaging 0.46
R6332:Zdbf2 UTSW 1 63307822 missense possibly damaging 0.66
R6361:Zdbf2 UTSW 1 63303321 missense possibly damaging 0.66
R6489:Zdbf2 UTSW 1 63307478 missense possibly damaging 0.46
R6517:Zdbf2 UTSW 1 63305520 missense possibly damaging 0.81
R6624:Zdbf2 UTSW 1 63303914 missense possibly damaging 0.46
R6643:Zdbf2 UTSW 1 63304508 missense possibly damaging 0.82
R6786:Zdbf2 UTSW 1 63304520 missense possibly damaging 0.46
R6808:Zdbf2 UTSW 1 63308528 missense possibly damaging 0.66
R6896:Zdbf2 UTSW 1 63308872 missense probably damaging 0.98
R6997:Zdbf2 UTSW 1 63290766 missense probably benign 0.09
R7011:Zdbf2 UTSW 1 63306766 missense possibly damaging 0.66
R7058:Zdbf2 UTSW 1 63307404 missense possibly damaging 0.66
R7066:Zdbf2 UTSW 1 63307559 missense probably benign
R7177:Zdbf2 UTSW 1 63294961 missense possibly damaging 0.94
R7184:Zdbf2 UTSW 1 63306505 missense possibly damaging 0.92
R7273:Zdbf2 UTSW 1 63303404 missense possibly damaging 0.90
R7387:Zdbf2 UTSW 1 63304039 missense possibly damaging 0.46
R7468:Zdbf2 UTSW 1 63307510 missense probably benign
R7695:Zdbf2 UTSW 1 63307370 missense possibly damaging 0.83
R7712:Zdbf2 UTSW 1 63305371 missense possibly damaging 0.83
R7735:Zdbf2 UTSW 1 63304105 missense possibly damaging 0.66
R7736:Zdbf2 UTSW 1 63308007 nonsense probably null
R7759:Zdbf2 UTSW 1 63308376 missense possibly damaging 0.46
R7796:Zdbf2 UTSW 1 63303424 missense possibly damaging 0.90
R7908:Zdbf2 UTSW 1 63306827 missense possibly damaging 0.46
RF021:Zdbf2 UTSW 1 63302652 missense possibly damaging 0.82
X0018:Zdbf2 UTSW 1 63305351 missense possibly damaging 0.92
X0027:Zdbf2 UTSW 1 63308007 nonsense probably null
X0057:Zdbf2 UTSW 1 63305390 missense possibly damaging 0.66
X0063:Zdbf2 UTSW 1 63305537 missense probably benign 0.04
Z1176:Zdbf2 UTSW 1 63304245 missense possibly damaging 0.83
Z1177:Zdbf2 UTSW 1 63304086 frame shift probably null
Z1177:Zdbf2 UTSW 1 63309203 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTGTGATGGTCCTGAAGTG -3'
(R):5'- CACACAAGTTACACTGCCCTTG -3'

Sequencing Primer
(F):5'- TCTAATGATCCCTGTCAGTCAGTAG -3'
(R):5'- GCCCTTGTCTTCTATGTCAAGCG -3'
Posted On2019-12-27