Incidental Mutation 'R0673:Nudt12'
Institutional Source Beutler Lab
Gene Symbol Nudt12
Ensembl Gene ENSMUSG00000024228
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 12
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0673 (G1)
Quality Score125
Status Not validated
Chromosomal Location58999618-59013372 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 59007622 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025065] [ENSMUST00000174122]
Predicted Effect probably null
Transcript: ENSMUST00000025065
SMART Domains Protein: ENSMUSP00000025065
Gene: ENSMUSG00000024228

ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 3.2e-10 PFAM
Pfam:zf-NADH-PPase 279 309 2.7e-10 PFAM
Pfam:NUDIX 322 447 8.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174108
Predicted Effect probably null
Transcript: ENSMUST00000174122
SMART Domains Protein: ENSMUSP00000133678
Gene: ENSMUSG00000024228

ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 2.4e-9 PFAM
Pfam:zf-NADH-PPase 279 311 5.9e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Nudt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02860:Nudt12 APN 17 59010435 missense probably benign 0.01
IGL02904:Nudt12 APN 17 59010352 missense probably benign 0.00
IGL03206:Nudt12 APN 17 59007672 missense probably benign 0.00
R0121:Nudt12 UTSW 17 59007639 missense possibly damaging 0.80
R0761:Nudt12 UTSW 17 59011069 missense probably benign 0.00
R1079:Nudt12 UTSW 17 59011037 splice site probably benign
R1277:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1815:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1816:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1834:Nudt12 UTSW 17 59011076 missense probably damaging 1.00
R2296:Nudt12 UTSW 17 59010049 missense possibly damaging 0.85
R2415:Nudt12 UTSW 17 59006608 missense probably damaging 0.99
R5011:Nudt12 UTSW 17 58996504 unclassified probably benign
R5384:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5385:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5874:Nudt12 UTSW 17 59010284 nonsense probably null
R6108:Nudt12 UTSW 17 59007749 missense probably damaging 1.00
R6477:Nudt12 UTSW 17 59011145 missense probably benign 0.12
R7030:Nudt12 UTSW 17 59003353 missense probably benign 0.22
R7592:Nudt12 UTSW 17 59006594 missense probably benign 0.02
R8252:Nudt12 UTSW 17 59011094 missense probably damaging 0.99
Z1177:Nudt12 UTSW 17 59011071 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- cagacaggtcagtggtgaag -3'
Posted On2013-07-30