Incidental Mutation 'R7989:Dlg2'
ID615450
Institutional Source Beutler Lab
Gene Symbol Dlg2
Ensembl Gene ENSMUSG00000052572
Gene Namediscs large MAGUK scaffold protein 2
SynonymsDlgh2, A330103J02Rik, Chapsyn-110, PSD93, B330007M19Rik, LOC382816, B230218P12Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7989 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location90476672-92449247 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 91900773 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 158 (V158E)
Ref Sequence ENSEMBL: ENSMUSP00000102814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074273] [ENSMUST00000107193] [ENSMUST00000107196] [ENSMUST00000231777]
PDB Structure
CRYSTAL STRUCTURE OF THE PSD93 PDZ1 DOMAIN [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000074273
AA Change: V158E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073885
Gene: ENSMUSG00000052572
AA Change: V158E

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
low complexity region 631 644 N/A INTRINSIC
GuKc 679 858 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107193
AA Change: V113E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102811
Gene: ENSMUSG00000052572
AA Change: V113E

DomainStartEndE-ValueType
low complexity region 45 57 N/A INTRINSIC
PDZ 61 140 1.15e-23 SMART
PDZ 156 235 9.86e-23 SMART
PDZ 332 405 1.77e-24 SMART
low complexity region 426 433 N/A INTRINSIC
SH3 442 508 7.82e-10 SMART
GuKc 564 743 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107196
AA Change: V158E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102814
Gene: ENSMUSG00000052572
AA Change: V158E

DomainStartEndE-ValueType
MAGUK_N_PEST 14 97 1.5e-47 SMART
PDZ 106 185 1.15e-23 SMART
PDZ 201 280 9.86e-23 SMART
PDZ 429 502 1.77e-24 SMART
low complexity region 523 530 N/A INTRINSIC
SH3 539 605 7.82e-10 SMART
GuKc 661 840 2.6e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000231777
AA Change: V263E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-associated guanylate kinase (MAGUK) family. The encoded protein forms a heterodimer with a related family member that may interact at postsynaptic sites to form a multimeric scaffold for the clustering of receptors, ion channels, and associated signaling proteins. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described, but their full-length nature is not known. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display lower surface expression of NMDA receptor (NMDAR) subunits NR2A and NR2B in dorsal horn neurons and significantly reduced NMDAR-mediated excitatory synaptic currents and NMDAR-dependent persistent inflammatory or nerve injury-induced neuropathic pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A T 12: 55,379,465 K533N possibly damaging Het
1110032A03Rik T A 9: 50,763,948 T153S possibly damaging Het
9530053A07Rik A T 7: 28,147,496 Y1168F probably benign Het
A4galt A G 15: 83,228,376 F69L probably benign Het
Acsf3 A G 8: 122,785,823 M328V probably damaging Het
Adam10 T G 9: 70,761,764 V454G possibly damaging Het
Adamts15 T C 9: 30,902,226 D881G probably benign Het
Adamtsl1 T C 4: 86,356,439 V1244A probably benign Het
Ankfn1 G A 11: 89,405,534 P123L probably damaging Het
Aox1 T C 1: 58,106,068 I1331T possibly damaging Het
Arntl A T 7: 113,313,473 I579L probably benign Het
Btnl4 A G 17: 34,473,187 M147T possibly damaging Het
Camk1g T C 1: 193,359,774 K56E probably damaging Het
Capn7 T C 14: 31,366,245 probably null Het
Cbln1 T A 8: 87,472,096 T49S probably benign Het
Cc2d2a T C 5: 43,706,846 V763A probably benign Het
Cdc40 A G 10: 40,848,046 Y249H probably damaging Het
Cfap61 T A 2: 146,102,099 L762H probably damaging Het
Cfap73 T C 5: 120,630,058 T212A probably benign Het
Cfi A G 3: 129,848,584 E29G probably benign Het
Clec14a T C 12: 58,267,679 T386A possibly damaging Het
Coq6 T A 12: 84,371,166 L268H probably damaging Het
Cpt1a T C 19: 3,362,202 S225P probably benign Het
Cyc1 C A 15: 76,343,591 probably null Het
Dhx58 C A 11: 100,695,304 L630F probably damaging Het
Foxd3 A G 4: 99,657,339 T239A probably benign Het
Galnt6 T C 15: 100,703,361 T346A probably damaging Het
Gm10234 A G 6: 95,322,160 probably null Het
Guca1b C G 17: 47,391,177 T185S unknown Het
H2-M5 T C 17: 36,987,679 T292A probably benign Het
Hlx T C 1: 184,727,576 H455R probably benign Het
Hydin A G 8: 110,510,867 Y1924C probably benign Het
Ighg2b C T 12: 113,306,454 V315M Het
Ildr2 A G 1: 166,307,800 K374E probably damaging Het
Jmjd1c T C 10: 67,225,842 S1144P probably benign Het
Kcnj8 T C 6: 142,566,029 D284G probably benign Het
Lingo4 A G 3: 94,402,234 T160A probably benign Het
Lmod3 G T 6: 97,248,473 A129E probably benign Het
Lrrk2 T C 15: 91,726,152 C696R probably damaging Het
Mc2r A G 18: 68,407,965 F86L probably benign Het
Mfsd7a T C 5: 108,444,497 I276V probably benign Het
Mppe1 T G 18: 67,228,984 K170T probably benign Het
Mtcl1 A G 17: 66,371,330 I667T possibly damaging Het
Mtnr1a A T 8: 45,087,826 I275F probably benign Het
Myh2 A G 11: 67,197,371 I1938V probably benign Het
Npsr1 A T 9: 24,289,800 E160V probably damaging Het
Olfr156 T A 4: 43,821,086 I92F probably damaging Het
Olfr788 T A 10: 129,472,998 I102N probably damaging Het
Ovch2 T A 7: 107,789,119 Y418F probably damaging Het
Pak7 A G 2: 136,116,559 L203S probably benign Het
Pcdh15 A T 10: 74,643,582 E508D probably benign Het
Prl7a1 T C 13: 27,642,450 M1V probably null Het
Prpsap2 G T 11: 61,756,272 N14K possibly damaging Het
Rad54b T A 4: 11,595,868 V215E probably null Het
Ryr2 G A 13: 11,792,748 T845I probably benign Het
Scgb2b3 G A 7: 31,362,014 T20I probably damaging Het
Serpina1b T C 12: 103,728,307 I393V possibly damaging Het
Slc13a5 T C 11: 72,259,064 M207V probably benign Het
Smg1 A T 7: 118,186,134 L843M unknown Het
Sp100 T C 1: 85,708,067 V531A possibly damaging Het
Srsf6 T C 2: 162,933,840 S190P unknown Het
Stil A G 4: 115,032,699 K795E possibly damaging Het
Sugp2 A G 8: 70,251,927 R705G probably benign Het
Tnfrsf11a T A 1: 105,809,374 C69S probably damaging Het
Trim30a A T 7: 104,421,449 N252K probably benign Het
Tshz1 T A 18: 84,014,607 K559* probably null Het
Ttbk1 C T 17: 46,478,938 R133H probably damaging Het
Unc79 T A 12: 103,063,089 probably null Het
Vmn1r1 T C 1: 182,157,350 Y250C probably benign Het
Vmn2r12 A G 5: 109,086,441 L635P probably damaging Het
Vwa5b1 A T 4: 138,569,170 L1182* probably null Het
Washc2 A G 6: 116,248,145 D818G probably benign Het
Xylb T G 9: 119,381,545 S365A probably benign Het
Zcchc8 T C 5: 123,720,720 probably benign Het
Zdbf2 T C 1: 63,306,827 I1455T possibly damaging Het
Other mutations in Dlg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Dlg2 APN 7 91965645 missense probably damaging 1.00
IGL01111:Dlg2 APN 7 91449763 missense possibly damaging 0.84
IGL01122:Dlg2 APN 7 92442608 missense possibly damaging 0.58
IGL01296:Dlg2 APN 7 91940059 missense probably damaging 1.00
IGL02063:Dlg2 APN 7 91810476 splice site probably benign
IGL02233:Dlg2 APN 7 92444538 missense probably damaging 1.00
IGL02519:Dlg2 APN 7 91940115 missense possibly damaging 0.54
IGL02833:Dlg2 APN 7 92431127 missense probably damaging 1.00
IGL03166:Dlg2 APN 7 91900730 splice site probably benign
R0932:Dlg2 UTSW 7 92375637 missense probably damaging 1.00
R1129:Dlg2 UTSW 7 92431174 splice site probably null
R1245:Dlg2 UTSW 7 92442595 splice site probably benign
R1319:Dlg2 UTSW 7 92438023 missense probably damaging 0.98
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1464:Dlg2 UTSW 7 91968198 missense probably damaging 1.00
R1596:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1650:Dlg2 UTSW 7 92431051 missense probably damaging 0.99
R1868:Dlg2 UTSW 7 92386952 nonsense probably null
R2006:Dlg2 UTSW 7 91965617 missense possibly damaging 0.95
R2026:Dlg2 UTSW 7 91965723 missense probably damaging 1.00
R2281:Dlg2 UTSW 7 92438041 missense probably damaging 1.00
R3721:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3722:Dlg2 UTSW 7 91711800 critical splice donor site probably null
R3793:Dlg2 UTSW 7 91810535 splice site probably benign
R4120:Dlg2 UTSW 7 91965638 missense probably damaging 1.00
R4444:Dlg2 UTSW 7 92088593 missense probably damaging 1.00
R4631:Dlg2 UTSW 7 92088614 missense probably damaging 1.00
R4672:Dlg2 UTSW 7 92286535 missense probably damaging 1.00
R4678:Dlg2 UTSW 7 92428580 missense possibly damaging 0.89
R4695:Dlg2 UTSW 7 92437962 splice site probably null
R5106:Dlg2 UTSW 7 92442686 missense probably damaging 0.99
R5355:Dlg2 UTSW 7 91449803 missense probably benign 0.41
R5385:Dlg2 UTSW 7 92088576 missense probably damaging 0.96
R5403:Dlg2 UTSW 7 92431002 missense probably damaging 1.00
R5504:Dlg2 UTSW 7 92442657 missense probably damaging 1.00
R5569:Dlg2 UTSW 7 91968180 missense probably benign 0.01
R5573:Dlg2 UTSW 7 91997324 splice site probably null
R5848:Dlg2 UTSW 7 92444527 missense probably benign 0.41
R5863:Dlg2 UTSW 7 91711779 missense probably benign 0.01
R5907:Dlg2 UTSW 7 91997371 intron probably benign
R6455:Dlg2 UTSW 7 92444508 splice site probably null
R6486:Dlg2 UTSW 7 91872374 critical splice acceptor site probably null
R6817:Dlg2 UTSW 7 91965664 missense probably benign 0.07
R7082:Dlg2 UTSW 7 90731984 missense probably benign
R7808:Dlg2 UTSW 7 92431055 missense probably benign 0.01
R7818:Dlg2 UTSW 7 91940017 missense probably damaging 0.99
R7908:Dlg2 UTSW 7 91900773 missense probably damaging 1.00
RF004:Dlg2 UTSW 7 90852677 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGGAGTATGAGCTTGACAC -3'
(R):5'- TGTCAGTGGGCAATGAAGGTC -3'

Sequencing Primer
(F):5'- GGAGTATGAGCTTGACACAATTTCTC -3'
(R):5'- GGTCAGAGAATTAAAGGCCTTTATAG -3'
Posted On2019-12-27