Incidental Mutation 'R7990:Maea'
ID615518
Institutional Source Beutler Lab
Gene Symbol Maea
Ensembl Gene ENSMUSG00000079562
Gene Namemacrophage erythroblast attacher
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7990 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location33335509-33373296 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33370474 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Cysteine at position 270 (F270C)
Ref Sequence ENSEMBL: ENSMUSP00000110093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114449]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114449
AA Change: F270C

PolyPhen 2 Score 0.714 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000110093
Gene: ENSMUSG00000079562
AA Change: F270C

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
LisH 121 153 3.01e-6 SMART
CTLH 159 216 2.16e-16 SMART
CRA 212 306 8.31e-14 SMART
low complexity region 347 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates the attachment of erythroblasts to macrophages. This attachment promotes terminal maturation and enucleation of erythroblasts, presumably by suppressing apoptosis. The encoded protein is an integral membrane protein with the N-terminus on the extracellular side and the C-terminus on the cytoplasmic side of the cell. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele die perinatally displaying reduced fetal size, pallor, reduced numbers of erythroblastic islands, defects in terminal erythroid maturation, and severely impaired terminal differentiation of fetal liver macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGGCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,137 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 CTGTGGTCACTGGTTCTGTGGTCACTGGTTT CTGTGGTCACTGGTTTTGTGGTCACTGGTTCTGTGGTCACTGGTTT 3: 95,888,161 probably benign Het
BC028528 TCACTGGTT TCACTGGTTCTGTGGGCACTGGTT 3: 95,888,182 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dsg1b T A 18: 20,405,210 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fmo9 A T 1: 166,677,469 probably null Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm14399 T C 2: 175,130,132 N610S probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Robo3 A C 9: 37,422,352 probably null Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Srgap3 G T 6: 112,739,427 probably null Het
Sult6b1 T C 17: 78,906,766 probably null Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Wdr59 A T 8: 111,460,756 probably null Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Maea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00925:Maea APN 5 33372301 missense probably benign 0.01
IGL01540:Maea APN 5 33358566 missense probably benign 0.12
R0365:Maea UTSW 5 33360443 missense probably benign 0.01
R0562:Maea UTSW 5 33372301 missense probably benign 0.01
R1450:Maea UTSW 5 33365800 critical splice donor site probably null
R1576:Maea UTSW 5 33362696 missense probably damaging 1.00
R2177:Maea UTSW 5 33371690 missense probably benign 0.00
R2520:Maea UTSW 5 33358510 missense probably damaging 0.98
R4580:Maea UTSW 5 33360488 missense possibly damaging 0.92
R4710:Maea UTSW 5 33368690 missense probably benign 0.01
R5786:Maea UTSW 5 33368683 missense probably benign 0.01
R6127:Maea UTSW 5 33335518 unclassified probably benign
R7178:Maea UTSW 5 33358510 missense probably damaging 0.98
R7542:Maea UTSW 5 33371663 missense probably damaging 1.00
R7828:Maea UTSW 5 33360378 missense probably benign 0.01
R7909:Maea UTSW 5 33370474 missense possibly damaging 0.71
R7909:Maea UTSW 5 33370476 nonsense probably null
R7990:Maea UTSW 5 33370476 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGATACAAACCAGGGAGTGTTCTC -3'
(R):5'- AGCCAGTATCAGGTACCAGC -3'

Sequencing Primer
(F):5'- GAGTGTTCTCCAAGTGTCACCAC -3'
(R):5'- CAGTATCAGGTACCAGCAACATTTG -3'
Posted On2019-12-27