Incidental Mutation 'R7990:Plxdc1'
ID615552
Institutional Source Beutler Lab
Gene Symbol Plxdc1
Ensembl Gene ENSMUSG00000017417
Gene Nameplexin domain containing 1
Synonyms2410003I07Rik, Tem7
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.460) question?
Stock #R7990 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location97923238-97986444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97932304 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 370 (D370E)
Ref Sequence ENSEMBL: ENSMUSP00000103191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017561] [ENSMUST00000107565]
Predicted Effect probably benign
Transcript: ENSMUST00000017561
AA Change: D363E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017561
Gene: ENSMUSG00000017417
AA Change: D363E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 304 349 5.98e-2 SMART
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107565
AA Change: D370E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103191
Gene: ENSMUSG00000017417
AA Change: D370E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
PSI 311 356 5.98e-2 SMART
transmembrane domain 432 454 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141708
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGGCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,137 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 CTGTGGTCACTGGTTCTGTGGTCACTGGTTT CTGTGGTCACTGGTTTTGTGGTCACTGGTTCTGTGGTCACTGGTTT 3: 95,888,161 probably benign Het
BC028528 TCACTGGTT TCACTGGTTCTGTGGGCACTGGTT 3: 95,888,182 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dsg1b T A 18: 20,405,210 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fmo9 A T 1: 166,677,469 probably null Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm14399 T C 2: 175,130,132 N610S probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Robo3 A C 9: 37,422,352 probably null Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Srgap3 G T 6: 112,739,427 probably null Het
Sult6b1 T C 17: 78,906,766 probably null Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Wdr59 A T 8: 111,460,756 probably null Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Plxdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01896:Plxdc1 APN 11 97924582 missense probably damaging 0.98
IGL02490:Plxdc1 APN 11 97954778 missense probably benign 0.17
IGL02568:Plxdc1 APN 11 97978564 missense probably damaging 1.00
IGL02618:Plxdc1 APN 11 97932304 missense probably benign
IGL03169:Plxdc1 APN 11 97932320 missense possibly damaging 0.80
R0200:Plxdc1 UTSW 11 97934012 missense probably damaging 1.00
R0627:Plxdc1 UTSW 11 97932204 splice site probably null
R1510:Plxdc1 UTSW 11 97932324 missense probably damaging 1.00
R2144:Plxdc1 UTSW 11 97934012 missense probably damaging 1.00
R5334:Plxdc1 UTSW 11 97956105 missense possibly damaging 0.87
R6084:Plxdc1 UTSW 11 97928463 missense probably damaging 1.00
R6243:Plxdc1 UTSW 11 97955473 missense probably damaging 1.00
R6305:Plxdc1 UTSW 11 97938590 missense probably damaging 1.00
R7224:Plxdc1 UTSW 11 97932327 missense possibly damaging 0.88
R7574:Plxdc1 UTSW 11 97956490 missense possibly damaging 0.89
R7633:Plxdc1 UTSW 11 97956151 missense possibly damaging 0.95
R7909:Plxdc1 UTSW 11 97932304 missense probably benign
R8056:Plxdc1 UTSW 11 97978517 missense probably damaging 0.99
RF007:Plxdc1 UTSW 11 97978678 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCCTGTGAGATGGCCCTAATC -3'
(R):5'- GTGAAGTGGGAGAGTCCATCTTAG -3'

Sequencing Primer
(F):5'- AATCAGGAATGGTCAGGCTCTTCC -3'
(R):5'- ATAGGTTCTCACTATGTTGACCAGGC -3'
Posted On2019-12-27