Mutagenetix > Incidental Mutation

Incidental Mutation 'R0674:Tiparp'

61556

Institutional Source

Beutler Lab

Gene Symbol

Tiparp

Ensembl Gene

ENSMUSG00000034640

Gene Name

TCDD-inducible poly(ADP-ribose) polymerase

Synonyms

PARP7, PARP-7, DDF1

MMRRC Submission

038859-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.788) question?

Stock #

R0674 (G1)

Quality Score

187

Status

Validated

Chromosome

Chromosomal Location

65528410-65555518 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 65553165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 525 (I525T)

Ref Sequence

ENSEMBL: ENSMUSP00000048051 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047906]

AlphaFold

Q8C1B2

Predicted Effect

probably benign
Transcript: ENSMUST00000047906
AA Change: I525T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000048051
Gene: ENSMUSG00000034640
AA Change: I525T

Domain	Start	End	E-Value	Type
Blast:ZnF_C3H1	238	264	2e-8	BLAST
Pfam:PARP	463	650	2e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154094

Meta Mutation Damage Score

0.0797

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.3%
20x: 90.4%

Validation Efficiency

97% (124/128)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the poly(ADP-ribose) polymerase superfamily. Studies of the mouse ortholog have shown that the encoded protein catalyzes histone poly(ADP-ribosyl)ation and may be involved in T-cell function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit postnatal lethality, skeletal and craniofacial defects, kidney defects and embryonic hemorrhaging. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 37,044,626	V1134E	possibly damaging	Het
Adar	A	G	3: 89,749,823		probably benign	Het
Adgrl2	A	T	3: 148,837,679	M803K	possibly damaging	Het
Atp13a5	T	C	16: 29,248,350		probably benign	Het
Atp2a3	T	C	11: 72,981,885	I753T	probably damaging	Het
Bace2	G	A	16: 97,436,749	V467M	possibly damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cd2ap	T	A	17: 42,845,392	I85F	possibly damaging	Het
Cd2bp2	C	T	7: 127,194,836	E94K	probably damaging	Het
Chrna3	C	A	9: 55,015,172	A451S	probably damaging	Het
Cmya5	C	A	13: 93,092,791	V1930F	probably damaging	Het
Csmd1	T	C	8: 16,000,550	T2229A	probably benign	Het
Csrnp2	A	T	15: 100,487,991	L122H	probably damaging	Het
Cyp11b2	G	A	15: 74,855,544	P96L	probably damaging	Het
Ddr1	G	T	17: 35,689,669	S368*	probably null	Het
E2f1	T	C	2: 154,564,109	K115E	probably damaging	Het
Erlec1	A	T	11: 30,935,073		probably benign	Het
Fus	T	A	7: 127,972,776		probably benign	Het
Gml	G	A	15: 74,813,860	T92I	probably damaging	Het
Herc1	T	C	9: 66,501,192	S4567P	probably damaging	Het
Iglc2	A	G	16: 19,198,841	S5P	probably benign	Het
Itgam	T	C	7: 128,116,218	V1028A	possibly damaging	Het
Krt222	T	A	11: 99,236,260	N178I	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Luzp1	C	T	4: 136,543,457	T997I	possibly damaging	Het
Maml1	G	T	11: 50,258,058	Q952K	probably benign	Het
Map2	A	G	1: 66,413,202	E499G	probably damaging	Het
Map4k4	A	T	1: 40,003,815	H118L	probably damaging	Het
Myzap	T	C	9: 71,515,144	D382G	probably damaging	Het
Naip5	T	C	13: 100,223,199	T510A	probably benign	Het
Nek6	G	C	2: 38,558,904	G95R	possibly damaging	Het
Nphp3	T	C	9: 104,036,282		probably null	Het
Nr1d2	T	C	14: 18,215,086	S309G	probably benign	Het
Nrcam	A	T	12: 44,564,322	I570F	probably benign	Het
Oas1d	T	C	5: 120,919,986	I331T	probably benign	Het
Olfr1306	A	T	2: 111,912,673	F86I	probably benign	Het
Olfr65	T	C	7: 103,907,255	V272A	probably benign	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pex5l	A	T	3: 32,952,616	W535R	probably damaging	Het
Pisd	C	T	5: 32,774,437	R202H	probably benign	Het
Plxna2	A	G	1: 194,649,475	N403S	probably benign	Het
Prdm12	A	G	2: 31,643,912	I180M	probably benign	Het
Prpf6	A	G	2: 181,631,974	T304A	probably benign	Het
Ptprm	G	A	17: 67,191,341	T35I	possibly damaging	Het
Ptx3	T	A	3: 66,224,727	I223N	probably damaging	Het
Pygb	G	A	2: 150,815,134		probably null	Het
Qrsl1	A	G	10: 43,896,001		probably benign	Het
Rad51ap2	T	C	12: 11,458,817		probably null	Het
Ralbp1	C	T	17: 65,852,753	R505H	probably benign	Het
Rimbp3	T	C	16: 17,212,737	S1342P	probably benign	Het
Slc22a14	C	A	9: 119,178,542	R267L	probably damaging	Het
Slco6c1	T	A	1: 97,104,773		probably benign	Het
Tcp1	T	C	17: 12,923,244	I375T	probably damaging	Het
Tjp2	A	G	19: 24,131,316	L144P	probably benign	Het
Tssk2	A	G	16: 17,899,066	D111G	probably benign	Het
Ttn	T	C	2: 76,945,479	T1740A	possibly damaging	Het
Vmn2r102	T	A	17: 19,677,867	D381E	probably benign	Het
Vsig10	C	T	5: 117,343,846	T367M	probably damaging	Het
Wnt11	T	C	7: 98,846,528	C80R	probably damaging	Het
Zar1	T	A	5: 72,580,300		probably null	Het
Zfp52	A	T	17: 21,561,846	H652L	probably damaging	Het
Zpr1	T	A	9: 46,275,449	L194Q	probably damaging	Het

Other mutations in Tiparp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00909:Tiparp	APN	3	65532109	missense	probably damaging	1.00
IGL01448:Tiparp	APN	3	65552609	nonsense	probably null
IGL01452:Tiparp	APN	3	65552609	nonsense	probably null
IGL01454:Tiparp	APN	3	65552609	nonsense	probably null
IGL01456:Tiparp	APN	3	65552609	nonsense	probably null
IGL01463:Tiparp	APN	3	65552609	nonsense	probably null
IGL01467:Tiparp	APN	3	65552609	nonsense	probably null
IGL01468:Tiparp	APN	3	65552609	nonsense	probably null
IGL01470:Tiparp	APN	3	65552609	nonsense	probably null
IGL01476:Tiparp	APN	3	65552609	nonsense	probably null
IGL01481:Tiparp	APN	3	65552609	nonsense	probably null
IGL01590:Tiparp	APN	3	65531976	missense	probably benign	0.14
IGL01684:Tiparp	APN	3	65553333	missense	probably damaging	0.99
IGL02322:Tiparp	APN	3	65532020	nonsense	probably null
IGL02572:Tiparp	APN	3	65531889	missense	probably benign	0.01
Albania	UTSW	3	65553527	missense	probably damaging	1.00
Moldova	UTSW	3	65553182	missense	probably damaging	1.00
BB003:Tiparp	UTSW	3	65553525	missense	possibly damaging	0.61
BB013:Tiparp	UTSW	3	65553525	missense	possibly damaging	0.61
R0401:Tiparp	UTSW	3	65531436	missense	probably benign	0.06
R1316:Tiparp	UTSW	3	65553351	missense	probably damaging	1.00
R1766:Tiparp	UTSW	3	65532049	missense	probably damaging	1.00
R2140:Tiparp	UTSW	3	65529252	intron	probably benign
R2568:Tiparp	UTSW	3	65553130	nonsense	probably null
R4533:Tiparp	UTSW	3	65546347	missense	probably benign	0.05
R4751:Tiparp	UTSW	3	65552804	missense	probably damaging	1.00
R4812:Tiparp	UTSW	3	65552769	missense	possibly damaging	0.94
R5268:Tiparp	UTSW	3	65547565	missense	possibly damaging	0.72
R5622:Tiparp	UTSW	3	65547525	missense	probably benign	0.00
R5693:Tiparp	UTSW	3	65553492	missense	possibly damaging	0.89
R5765:Tiparp	UTSW	3	65531350	missense	possibly damaging	0.69
R6061:Tiparp	UTSW	3	65553243	missense	probably damaging	0.98
R6875:Tiparp	UTSW	3	65531642	missense	probably benign	0.01
R7123:Tiparp	UTSW	3	65553527	missense	probably damaging	1.00
R7926:Tiparp	UTSW	3	65553525	missense	possibly damaging	0.61
R8023:Tiparp	UTSW	3	65531803	missense	probably benign	0.01
R8234:Tiparp	UTSW	3	65531581	missense	probably benign
R8416:Tiparp	UTSW	3	65531346	missense	probably benign	0.00
R8487:Tiparp	UTSW	3	65546234	missense	probably benign	0.06
R8547:Tiparp	UTSW	3	65546377	critical splice donor site	probably null
R8690:Tiparp	UTSW	3	65553542	missense	probably benign	0.17
R8750:Tiparp	UTSW	3	65552704	missense	probably damaging	0.99
R8900:Tiparp	UTSW	3	65553182	missense	probably damaging	1.00
R8940:Tiparp	UTSW	3	65531878	missense	probably benign	0.00
R9323:Tiparp	UTSW	3	65531851	missense	probably benign	0.01
R9505:Tiparp	UTSW	3	65532156	nonsense	probably null
R9558:Tiparp	UTSW	3	65531431	missense	possibly damaging	0.96
R9597:Tiparp	UTSW	3	65531280	missense	probably benign
R9799:Tiparp	UTSW	3	65547552	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AGGACTTCATCCAAGTGCCTGTTTC -3'
(R):5'- GCCATGACTGCCCATTGTGTATCTG -3'

Sequencing Primer
(F):5'- GAGTCCAAAACCAATTTCTTTGGGAG -3'
(R):5'- GTGTATCTGCCAGTTAACACTTTG -3'

Posted On

2013-07-30