Incidental Mutation 'R7990:Dsg1b'
ID615574
Institutional Source Beutler Lab
Gene Symbol Dsg1b
Ensembl Gene ENSMUSG00000061928
Gene Namedesmoglein 1 beta
SynonymsDsg5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7990 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location20376729-20410196 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 20405210 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076737]
Predicted Effect probably null
Transcript: ENSMUST00000076737
SMART Domains Protein: ENSMUSP00000076026
Gene: ENSMUSG00000061928

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 70 155 3.45e-14 SMART
CA 179 267 3.11e-21 SMART
CA 290 384 6.29e-8 SMART
CA 407 491 3.92e-1 SMART
low complexity region 523 541 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Pfam:Cadherin_C 662 784 1.6e-10 PFAM
low complexity region 789 802 N/A INTRINSIC
low complexity region 884 896 N/A INTRINSIC
low complexity region 984 1006 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of proteins that forms an integral transmembrane component of desmosomes, the multiprotein complexes involved in cell adhesion, organization of the cytoskeleton, cell sorting and cell signaling. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930412O13Rik C A 2: 9,883,857 P91Q unknown Het
Abhd4 C T 14: 54,261,630 Q23* probably null Het
Acaca T A 11: 84,245,235 I472N possibly damaging Het
Angptl7 T C 4: 148,496,210 N320S probably benign Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
BC028528 TCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGGCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGG 3: 95,888,137 probably benign Het
BC028528 ACTGGTTCTGTGGTCACTGGTTCTGTGGTC ACTGGTTCTGTGGTCGCTGGTTCTGTGGTCACTGGTTCTGTGGTC 3: 95,888,154 probably benign Het
BC028528 CTGTGGTCACTGGTTCTGTGGTCACTGGTTT CTGTGGTCACTGGTTTTGTGGTCACTGGTTCTGTGGTCACTGGTTT 3: 95,888,161 probably benign Het
BC028528 TCACTGGTT TCACTGGTTCTGTGGGCACTGGTT 3: 95,888,182 probably benign Het
Ccdc13 T A 9: 121,833,860 M30L probably benign Het
Ceacam9 A G 7: 16,723,868 Y102C probably damaging Het
Dennd4a G T 9: 64,872,993 probably null Het
Dusp1 A T 17: 26,507,612 S159T probably benign Het
Dyrk3 A T 1: 131,129,587 V283E probably damaging Het
Fam208b T C 13: 3,573,765 I2062V possibly damaging Het
Fmo9 A T 1: 166,677,469 probably null Het
Fndc7 A T 3: 108,862,916 S651T probably benign Het
Gcnt2 T A 13: 40,860,450 H32Q probably benign Het
Gkn2 T A 6: 87,375,894 H68Q possibly damaging Het
Gm14399 T C 2: 175,130,132 N610S probably damaging Het
Gm15448 T C 7: 3,821,709 K559R unknown Het
Gria4 G T 9: 4,464,450 T504K probably damaging Het
Gstm4 T A 3: 108,043,416 T90S probably benign Het
Hbs1l G A 10: 21,358,404 probably null Het
Hdhd5 C A 6: 120,531,191 R34S probably benign Het
Ighv10-1 A T 12: 114,479,044 L107* probably null Het
Ints6 A T 14: 62,759,330 H70Q probably damaging Het
K230010J24Rik G T 15: 76,046,841 R537L possibly damaging Het
Kcnc3 T A 7: 44,595,687 I467N probably damaging Het
Klhl9 A T 4: 88,721,001 D334E probably benign Het
Lama5 T A 2: 180,192,276 N1427I possibly damaging Het
Lrch3 T A 16: 33,009,293 F764L probably benign Het
Lyar T A 5: 38,224,728 V18E probably damaging Het
Maea T G 5: 33,370,474 F270C possibly damaging Het
Maea C T 5: 33,370,476 R271* probably null Het
Mttp T A 3: 138,118,417 K133* probably null Het
Nme6 T A 9: 109,841,968 I92N probably damaging Het
Nqo2 T A 13: 33,972,431 Y43N probably damaging Het
Nup153 C T 13: 46,693,580 C791Y probably damaging Het
Ogdh A G 11: 6,313,965 I134V possibly damaging Het
Olfr703 G A 7: 106,844,992 C127Y probably benign Het
Olfr777 G T 10: 129,269,267 Q19K probably benign Het
Olfr875 T C 9: 37,772,737 L26P probably damaging Het
Pde6b A T 5: 108,403,422 M191L probably benign Het
Plxdc1 A T 11: 97,932,304 D370E probably benign Het
Pnldc1 C A 17: 12,903,211 A187S probably benign Het
Psrc1 T C 3: 108,385,251 V120A probably damaging Het
Rbpms A G 8: 33,864,359 S53P probably damaging Het
Robo3 A C 9: 37,422,352 probably null Het
Rtl1 G A 12: 109,590,177 L1743F unknown Het
Rtl1 T A 12: 109,592,480 N975I possibly damaging Het
Rtn3 A G 19: 7,456,462 S722P possibly damaging Het
Safb A G 17: 56,595,665 D187G unknown Het
Sept5 A G 16: 18,624,622 V153A probably damaging Het
Sesn1 T C 10: 41,811,116 V32A probably benign Het
Shank2 A T 7: 144,411,394 H913L probably damaging Het
Slc19a1 T A 10: 77,049,540 F425I probably damaging Het
Slc4a11 A G 2: 130,692,300 M26T probably benign Het
Srgap3 G T 6: 112,739,427 probably null Het
Sult6b1 T C 17: 78,906,766 probably null Het
Sybu G T 15: 44,673,037 S631* probably null Het
Sycp1 A T 3: 102,820,626 Y890* probably null Het
Tcaf3 A G 6: 42,591,964 V583A possibly damaging Het
Tctn1 A G 5: 122,261,410 V117A probably damaging Het
Tmem74 A T 15: 43,867,399 S83T probably benign Het
Tmem91 T C 7: 25,670,565 D94G probably damaging Het
Tnks A T 8: 34,940,704 V290D probably damaging Het
Tns4 A G 11: 99,086,023 L24P probably damaging Het
Tnxb A G 17: 34,692,454 H1577R probably benign Het
Tpm2 A T 4: 43,515,939 N279K probably benign Het
Trim34b A G 7: 104,330,524 T148A probably benign Het
Ttf1 T A 2: 29,065,459 S278R probably benign Het
Utp20 A T 10: 88,775,330 V1375E probably benign Het
Vps13a G A 19: 16,720,430 R774* probably null Het
Vsnl1 A T 12: 11,326,454 D143E probably benign Het
Wdr59 A T 8: 111,460,756 probably null Het
Yme1l1 T A 2: 23,194,757 N622K probably benign Het
Zfp106 A G 2: 120,514,219 V1748A probably damaging Het
Zfp513 C T 5: 31,200,562 V158M possibly damaging Het
Zfp607a A T 7: 27,879,094 I530F probably damaging Het
Other mutations in Dsg1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dsg1b APN 18 20396476 missense probably damaging 1.00
IGL00675:Dsg1b APN 18 20391918 nonsense probably null
IGL01071:Dsg1b APN 18 20409215 missense probably damaging 1.00
IGL01589:Dsg1b APN 18 20409594 missense probably damaging 1.00
IGL01729:Dsg1b APN 18 20405238 missense possibly damaging 0.66
IGL01753:Dsg1b APN 18 20397849 splice site probably benign
IGL02560:Dsg1b APN 18 20409178 missense possibly damaging 0.80
IGL02654:Dsg1b APN 18 20409262 missense probably damaging 1.00
IGL02726:Dsg1b APN 18 20399485 missense probably benign
IGL03272:Dsg1b APN 18 20397389 missense probably benign 0.25
IGL03342:Dsg1b APN 18 20409460 missense probably benign 0.09
IGL02835:Dsg1b UTSW 18 20392014 missense possibly damaging 0.66
R0080:Dsg1b UTSW 18 20397367 missense probably damaging 1.00
R0133:Dsg1b UTSW 18 20404878 missense probably damaging 0.96
R0455:Dsg1b UTSW 18 20396025 missense probably benign 0.02
R0498:Dsg1b UTSW 18 20409333 missense possibly damaging 0.95
R0518:Dsg1b UTSW 18 20388164 missense probably benign 0.00
R1418:Dsg1b UTSW 18 20397430 nonsense probably null
R1429:Dsg1b UTSW 18 20390195 missense probably damaging 1.00
R1450:Dsg1b UTSW 18 20409184 missense probably damaging 1.00
R1569:Dsg1b UTSW 18 20396480 missense probably damaging 1.00
R1674:Dsg1b UTSW 18 20399521 missense probably benign
R1934:Dsg1b UTSW 18 20395906 missense probably damaging 1.00
R2004:Dsg1b UTSW 18 20396475 missense probably damaging 0.99
R2191:Dsg1b UTSW 18 20409618 makesense probably null
R2192:Dsg1b UTSW 18 20409618 makesense probably null
R2927:Dsg1b UTSW 18 20405251 missense probably benign 0.23
R3777:Dsg1b UTSW 18 20399587 missense probably damaging 1.00
R3801:Dsg1b UTSW 18 20390203 missense probably damaging 1.00
R4205:Dsg1b UTSW 18 20408821 missense probably damaging 1.00
R4718:Dsg1b UTSW 18 20397929 missense probably damaging 0.98
R4853:Dsg1b UTSW 18 20408736 missense probably benign 0.01
R4853:Dsg1b UTSW 18 20390132 critical splice acceptor site probably null
R4981:Dsg1b UTSW 18 20408868 missense possibly damaging 0.66
R5125:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5178:Dsg1b UTSW 18 20397503 missense probably damaging 1.00
R5213:Dsg1b UTSW 18 20395930 missense probably damaging 1.00
R5450:Dsg1b UTSW 18 20409064 missense probably damaging 1.00
R5605:Dsg1b UTSW 18 20399539 missense probably benign
R5778:Dsg1b UTSW 18 20409222 missense possibly damaging 0.66
R5808:Dsg1b UTSW 18 20408725 missense probably damaging 1.00
R6144:Dsg1b UTSW 18 20396419 missense possibly damaging 0.92
R6185:Dsg1b UTSW 18 20399486 missense probably benign
R6268:Dsg1b UTSW 18 20388163 missense probably benign 0.01
R6291:Dsg1b UTSW 18 20404791 missense possibly damaging 0.71
R6342:Dsg1b UTSW 18 20390243 missense probably damaging 1.00
R6449:Dsg1b UTSW 18 20394441 missense possibly damaging 0.82
R6566:Dsg1b UTSW 18 20397442 missense probably damaging 1.00
R6817:Dsg1b UTSW 18 20394405 missense probably damaging 1.00
R7235:Dsg1b UTSW 18 20399423 missense probably benign 0.01
R7857:Dsg1b UTSW 18 20396463 missense probably benign 0.06
R7940:Dsg1b UTSW 18 20396463 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTCAAAATTCAGTAGAGGTCACC -3'
(R):5'- CAGTTTCAGTAGGCTGTCCTTTATC -3'

Sequencing Primer
(F):5'- TTCAGTAGAGGTCACCAGCCAAG -3'
(R):5'- AGTAGGCTGTCCTTTATCATTCATC -3'
Posted On2019-12-27