Incidental Mutation 'R7991:C4b'
ID615656
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7991 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34740352 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 416 (L416P)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably benign
Transcript: ENSMUST00000069507
AA Change: L416P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: L416P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173057
SMART Domains Protein: ENSMUSP00000134611
Gene: ENSMUSG00000073418

DomainStartEndE-ValueType
Pfam:A2M 1 62 6.5e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik A T 6: 65,953,305 T175S probably benign Het
Abca13 A G 11: 9,581,590 I4606V probably damaging Het
Abca3 G A 17: 24,385,853 V645I probably benign Het
Abi3bp A T 16: 56,677,742 R980* probably null Het
Acsl6 G T 11: 54,345,971 G564* probably null Het
Ada T A 2: 163,735,346 probably null Het
Alppl2 T C 1: 87,087,437 E430G probably benign Het
Anks1b A G 10: 90,680,792 Y883C probably damaging Het
Atp11b T C 3: 35,831,503 F882L possibly damaging Het
Atrn T A 2: 130,964,887 H609Q probably benign Het
Bcl2l13 A T 6: 120,865,685 K113M possibly damaging Het
Brinp2 T A 1: 158,246,880 N557I probably damaging Het
Ccdc125 T A 13: 100,682,819 I163K possibly damaging Het
Ccdc136 T G 6: 29,420,034 D1075E probably benign Het
Cdc45 T A 16: 18,810,453 Y47F probably damaging Het
Cdk10 T C 8: 123,226,366 V36A probably damaging Het
Ciz1 T A 2: 32,370,127 probably null Het
Clasp1 T G 1: 118,602,414 L1502* probably null Het
Crtc1 G T 8: 70,387,601 Q541K probably benign Het
Ddx5 G T 11: 106,784,435 T358N probably damaging Het
Ehbp1l1 A T 19: 5,716,424 V1297E probably benign Het
Eif2d C A 1: 131,155,213 T98K probably damaging Het
Ezh2 T C 6: 47,556,143 D124G probably damaging Het
Gamt T G 10: 80,258,409 I223L possibly damaging Het
Gbp7 T C 3: 142,534,641 V40A probably damaging Het
Gm11992 A G 11: 9,049,165 E7G probably damaging Het
Gml2 A G 15: 74,820,530 probably null Het
Grem2 A G 1: 174,837,247 V12A probably benign Het
Gsta1 T A 9: 78,232,295 I19N probably damaging Het
Gstt2 T C 10: 75,831,902 I240V probably benign Het
Hectd4 T C 5: 121,254,228 L185S possibly damaging Het
Hsd3b7 G A 7: 127,801,247 probably null Het
Ift22 T A 5: 136,911,784 M101K probably benign Het
Irs1 A G 1: 82,290,081 V138A probably benign Het
Ky A G 9: 102,541,942 M383V possibly damaging Het
Lama4 A G 10: 39,070,009 E796G probably damaging Het
Lcp2 A G 11: 34,088,061 Y426C probably damaging Het
Lig3 A G 11: 82,797,775 D755G probably damaging Het
Lrrc43 T A 5: 123,492,407 I111N probably damaging Het
Lrrc43 A G 5: 123,501,021 D371G probably benign Het
Lrrc74b C A 16: 17,558,349 G146* probably null Het
Lrrfip1 A G 1: 91,120,152 K479E possibly damaging Het
Lrriq1 C A 10: 103,215,194 E566* probably null Het
Mbnl2 T A 14: 120,403,323 probably null Het
Mlxipl C T 5: 135,132,409 A394V possibly damaging Het
Myh14 T C 7: 44,632,395 Y813C probably damaging Het
Nat10 T A 2: 103,725,145 E943D probably benign Het
Nectin2 T A 7: 19,732,987 K226* probably null Het
Nlrc5 T G 8: 94,493,092 S1103R probably benign Het
Nr4a1 T A 15: 101,271,760 Y304N probably damaging Het
Ntpcr T C 8: 125,747,744 V184A probably benign Het
Olfr141 A G 2: 86,806,847 S51P probably benign Het
Olfr341 T A 2: 36,479,333 N266Y probably damaging Het
Olfr498 T C 7: 108,465,771 V149A probably benign Het
Oxr1 A C 15: 41,653,634 S65R possibly damaging Het
Pcdhb19 A T 18: 37,497,667 I172L probably benign Het
Pds5a A T 5: 65,638,582 I655N possibly damaging Het
Pik3cg T C 12: 32,200,517 Y757C probably benign Het
Plekha5 C A 6: 140,526,458 T37N possibly damaging Het
Ppp4r1 T A 17: 65,811,303 F167I probably benign Het
Ppp4r1 C T 17: 65,829,399 A534V probably damaging Het
Ppt2 T A 17: 34,627,326 probably null Het
Prrt2 A T 7: 127,020,047 V82D possibly damaging Het
Rassf5 T A 1: 131,180,629 Y338F probably benign Het
Rbbp6 G A 7: 122,997,028 V560I possibly damaging Het
Rcbtb1 T C 14: 59,236,678 M90T unknown Het
Rif1 T A 2: 52,078,387 L194* probably null Het
Rybp A T 6: 100,232,918 I128K possibly damaging Het
Samm50 T G 15: 84,214,145 F462V possibly damaging Het
Slain1 T C 14: 103,685,764 Y264H probably damaging Het
Slc29a4 C T 5: 142,705,401 P12L probably benign Het
Slc6a2 T C 8: 92,994,138 I461T possibly damaging Het
Soat2 A G 15: 102,160,671 D377G probably damaging Het
Spocd1 A G 4: 129,930,100 E230G Het
Tbc1d30 T A 10: 121,347,156 K126* probably null Het
Tbc1d9 T A 8: 83,241,817 probably null Het
Tgfbi T A 13: 56,632,184 F515L probably damaging Het
Utf1 A G 7: 139,944,791 probably benign Het
Vmn1r206 G T 13: 22,620,301 Y245* probably null Het
Vmn1r87 T A 7: 13,131,905 S152C probably damaging Het
Zfc3h1 C A 10: 115,420,683 Y1519* probably null Het
Zfp248 A T 6: 118,430,142 L162H possibly damaging Het
Zfp804a T A 2: 82,256,573 F249I probably damaging Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
Aspiration UTSW 17 34734442 missense probably benign 0.00
Inspiration UTSW 17 34732166 splice site probably null
perspiration UTSW 17 34729831 missense probably damaging 1.00
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0113:C4b UTSW 17 34741240 missense probably damaging 0.98
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
R6962:C4b UTSW 17 34732166 splice site probably null
R7068:C4b UTSW 17 34733477 missense probably damaging 1.00
R7081:C4b UTSW 17 34735443 missense probably benign 0.27
R7105:C4b UTSW 17 34730911 missense possibly damaging 0.52
R7211:C4b UTSW 17 34735534 missense possibly damaging 0.92
R7296:C4b UTSW 17 34743659 missense probably damaging 1.00
R7314:C4b UTSW 17 34740356 missense probably benign
R7330:C4b UTSW 17 34730472 missense probably damaging 1.00
R7397:C4b UTSW 17 34742390 missense possibly damaging 0.80
R7437:C4b UTSW 17 34734733 missense probably benign 0.10
R7490:C4b UTSW 17 34731080 nonsense probably null
R7597:C4b UTSW 17 34739675 missense probably benign
R7633:C4b UTSW 17 34729399 critical splice donor site probably null
R7900:C4b UTSW 17 34739777 missense probably benign 0.03
R7910:C4b UTSW 17 34740352 missense probably benign 0.00
R7983:C4b UTSW 17 34739777 missense probably benign 0.03
Z1176:C4b UTSW 17 34731147 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCCAAGGACCCAAATGTG -3'
(R):5'- CCGCACTAAGAGGCATCTTG -3'

Sequencing Primer
(F):5'- AAATGTGCCACCCCTTCC -3'
(R):5'- CTGCTGCAGGTTCCTCTTGG -3'
Posted On2019-12-27