Incidental Mutation 'R7992:D1Ertd622e'
ID615663
Institutional Source Beutler Lab
Gene Symbol D1Ertd622e
Ensembl Gene ENSMUSG00000044768
Gene NameDNA segment, Chr 1, ERATO Doi 622, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R7992 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location97606318-97662074 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97645890 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 150 (H150L)
Ref Sequence ENSEMBL: ENSMUSP00000051034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053033] [ENSMUST00000142234] [ENSMUST00000149927] [ENSMUST00000153115]
Predicted Effect probably damaging
Transcript: ENSMUST00000053033
AA Change: H150L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000051034
Gene: ENSMUSG00000044768
AA Change: H150L

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142234
SMART Domains Protein: ENSMUSP00000137803
Gene: ENSMUSG00000044768

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 134 1.1e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149927
AA Change: H150L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121997
Gene: ENSMUSG00000044768
AA Change: H150L

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 8.7e-116 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000153115
AA Change: H150L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138031
Gene: ENSMUSG00000044768
AA Change: H150L

DomainStartEndE-ValueType
Pfam:UNC119_bdg 3 201 2.3e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Calcrl A C 2: 84,351,231 I191S probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Chst15 T C 7: 132,270,522 Q10R probably benign Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Farp1 T C 14: 121,242,406 S370P probably damaging Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Hsh2d A G 8: 72,196,804 E45G probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Usp53 T C 3: 122,961,267 M180V probably benign Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in D1Ertd622e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01486:D1Ertd622e APN 1 97646006 missense probably damaging 0.99
IGL02349:D1Ertd622e APN 1 97646052 missense probably damaging 1.00
R0577:D1Ertd622e UTSW 1 97661826 splice site probably null
R1646:D1Ertd622e UTSW 1 97645806 missense probably damaging 0.99
R3611:D1Ertd622e UTSW 1 97646334 missense probably damaging 1.00
R5270:D1Ertd622e UTSW 1 97645995 missense probably damaging 1.00
R5934:D1Ertd622e UTSW 1 97645930 missense possibly damaging 0.69
R6863:D1Ertd622e UTSW 1 97646305 missense probably benign
R7133:D1Ertd622e UTSW 1 97645920 missense probably benign 0.01
R7911:D1Ertd622e UTSW 1 97645890 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACGCCACTCATGTATTGTTTCTAG -3'
(R):5'- GTTAGCCCAGAAGTGCACAG -3'

Sequencing Primer
(F):5'- GTTTCTAGCAAACACTCGGTC -3'
(R):5'- GCCTTGCGCGCTAAACAG -3'
Posted On2019-12-27