Incidental Mutation 'R7992:Usp53'
ID615676
Institutional Source Beutler Lab
Gene Symbol Usp53
Ensembl Gene ENSMUSG00000039701
Gene Nameubiquitin specific peptidase 53
SynonymsPhxr3, Sp6
Accession Numbers

Ncbi RefSeq: NM_133857.3; MGI: 2139607

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7992 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location122931493-122984510 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 122961267 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 180 (M180V)
Ref Sequence ENSEMBL: ENSMUSP00000143412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090379] [ENSMUST00000197314] [ENSMUST00000197934] [ENSMUST00000199329] [ENSMUST00000199401]
Predicted Effect probably benign
Transcript: ENSMUST00000090379
SMART Domains Protein: ENSMUSP00000087857
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 348 1.6e-20 PFAM
Pfam:UCH_1 30 322 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197314
SMART Domains Protein: ENSMUSP00000142600
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 266 1.7e-15 PFAM
Pfam:UCH_1 30 266 2.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197934
AA Change: M180V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143412
Gene: ENSMUSG00000039701
AA Change: M180V

DomainStartEndE-ValueType
Pfam:UCH 29 375 2.2e-21 PFAM
Pfam:UCH_1 30 349 5.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199329
SMART Domains Protein: ENSMUSP00000143119
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
Pfam:UCH 29 126 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199401
SMART Domains Protein: ENSMUSP00000143460
Gene: ENSMUSG00000039701

DomainStartEndE-ValueType
low complexity region 76 87 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss associated with altered cochlear outer hair cell (OHC) morphology, reduced endocochlear potential, and early OHC loss followed by IHC and spiral ganglion degeneration. Heterozygotes are susceptible to noise-induced hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(48) : Gene trapped(48)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T A 5: 98,737,708 M158K possibly damaging Het
1700028K03Rik T C 5: 107,545,801 F95L probably benign Het
Abca3 C G 17: 24,398,504 D1058E probably damaging Het
Abca7 C A 10: 80,005,033 R919S probably benign Het
Abcc2 T C 19: 43,803,670 S297P probably benign Het
Abcc8 A G 7: 46,154,436 L438P probably damaging Het
Acbd6 C A 1: 155,687,004 D250E probably damaging Het
Ankrd31 A G 13: 96,879,100 N1626D possibly damaging Het
Arrdc4 C T 7: 68,745,176 E112K probably benign Het
B3galnt1 T A 3: 69,575,241 Y229F probably damaging Het
Calcrl A C 2: 84,351,231 I191S probably damaging Het
Camkmt T A 17: 85,452,438 probably null Het
Card11 A G 5: 140,882,000 probably null Het
Cfap157 A G 2: 32,778,207 L407P probably damaging Het
Chst15 T C 7: 132,270,522 Q10R probably benign Het
Col26a1 A G 5: 136,743,098 L424P probably damaging Het
Cryzl2 T C 1: 157,472,355 M308T probably benign Het
Ctu2 T C 8: 122,480,994 I403T probably benign Het
D1Ertd622e T A 1: 97,645,890 H150L probably damaging Het
Ddhd2 A G 8: 25,748,536 probably null Het
Dmrt1 T A 19: 25,603,328 L368Q probably benign Het
Dnah7b C A 1: 46,139,678 P837Q probably damaging Het
Drg2 T A 11: 60,464,175 L283Q possibly damaging Het
Dscam G A 16: 96,643,922 T1523I probably benign Het
Farp1 T C 14: 121,242,406 S370P probably damaging Het
Fbxl21 G A 13: 56,537,163 G360D probably damaging Het
Fbxo39 T C 11: 72,317,532 S237P probably damaging Het
Gart G T 16: 91,638,784 F180L probably benign Het
Gng4 T C 13: 13,825,272 L42P possibly damaging Het
Heatr9 T A 11: 83,512,408 D435V probably damaging Het
Hsh2d A G 8: 72,196,804 E45G probably damaging Het
Ighv1-74 A G 12: 115,802,790 I70T probably damaging Het
Igkv1-133 T A 6: 67,724,940 F9L probably benign Het
Jmjd1c T C 10: 67,231,995 V1578A probably damaging Het
Kcnj5 T C 9: 32,322,221 D266G probably damaging Het
Klk1b9 A T 7: 43,979,787 K206N probably damaging Het
Madd C T 2: 91,167,508 G725D probably null Het
Mki67 A T 7: 135,704,604 H576Q probably damaging Het
Mprip T A 11: 59,760,855 I36N Het
Mycbp2 T G 14: 103,200,185 E2113D probably damaging Het
Narfl A G 17: 25,780,398 E262G probably benign Het
Noa1 T C 5: 77,309,830 Y76C probably damaging Het
Noct A G 3: 51,247,648 probably benign Het
Pcdhga6 C T 18: 37,709,426 S733L not run Het
Pdlim7 T C 13: 55,499,106 E389G probably damaging Het
Ppip5k1 A G 2: 121,342,658 Y480H possibly damaging Het
Prc1 T A 7: 80,304,372 D93E probably benign Het
Ptpn13 G A 5: 103,541,058 A906T probably damaging Het
Ptpn21 T C 12: 98,688,842 E622G probably damaging Het
Pum1 T C 4: 130,774,477 V1104A probably benign Het
Scn2a G A 2: 65,682,083 R188Q probably null Het
Sh3pxd2b G A 11: 32,371,533 V31I probably damaging Het
Skor1 T C 9: 63,145,046 E547G possibly damaging Het
Slk C T 19: 47,615,229 T183I Het
Sorcs1 C A 19: 50,144,032 D1163Y unknown Het
Tex14 G A 11: 87,533,602 probably null Het
Them5 A G 3: 94,346,189 T169A possibly damaging Het
Tmem56 A T 3: 121,228,392 I119K probably damaging Het
Trav5-4 T C 14: 53,704,451 F94L probably benign Het
Trpc6 G C 9: 8,656,704 G789R probably benign Het
Ttn A T 2: 76,706,751 C34944* probably null Het
Vwa3b T C 1: 37,154,026 S8P probably damaging Het
Wdr90 A T 17: 25,850,749 M1205K probably benign Het
Zcwpw1 A T 5: 137,796,770 E76V probably null Het
Other mutations in Usp53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01112:Usp53 APN 3 122957718 missense probably damaging 0.99
IGL01965:Usp53 APN 3 122961153 critical splice donor site probably null
IGL02115:Usp53 APN 3 122947390 missense probably benign 0.25
IGL02993:Usp53 APN 3 122933843 missense probably damaging 1.00
IGL03119:Usp53 APN 3 122961415 missense possibly damaging 0.80
IGL03206:Usp53 APN 3 122953183 missense probably benign
IGL03369:Usp53 APN 3 122933721 utr 3 prime probably benign
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0066:Usp53 UTSW 3 122953307 nonsense probably null
R0366:Usp53 UTSW 3 122949201 missense probably damaging 1.00
R1015:Usp53 UTSW 3 122933759 missense probably benign 0.02
R1388:Usp53 UTSW 3 122957628 missense probably damaging 0.96
R1592:Usp53 UTSW 3 122934050 nonsense probably null
R1635:Usp53 UTSW 3 122934223 missense probably benign 0.03
R1707:Usp53 UTSW 3 122947400 missense probably benign
R2177:Usp53 UTSW 3 122936057 missense probably damaging 0.99
R2848:Usp53 UTSW 3 122934491 missense probably benign 0.00
R2898:Usp53 UTSW 3 122957574 nonsense probably null
R3411:Usp53 UTSW 3 122949858 critical splice acceptor site probably null
R3618:Usp53 UTSW 3 122934412 missense probably benign 0.25
R3713:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3715:Usp53 UTSW 3 122949319 missense probably benign 0.08
R3923:Usp53 UTSW 3 122934305 missense probably benign 0.11
R4616:Usp53 UTSW 3 122959120 missense probably damaging 1.00
R4718:Usp53 UTSW 3 122933982 missense probably benign 0.22
R4730:Usp53 UTSW 3 122962933 missense probably null 0.82
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R4860:Usp53 UTSW 3 122961363 missense possibly damaging 0.90
R5073:Usp53 UTSW 3 122933946 missense probably benign 0.21
R5580:Usp53 UTSW 3 122934234 missense probably benign 0.00
R5894:Usp53 UTSW 3 122959085 missense probably damaging 0.96
R6176:Usp53 UTSW 3 122934003 nonsense probably null
R6191:Usp53 UTSW 3 122949741 missense probably damaging 0.96
R6634:Usp53 UTSW 3 122964286 missense probably benign 0.00
R7179:Usp53 UTSW 3 122949710 missense probably benign 0.01
R7211:Usp53 UTSW 3 122957650 missense probably damaging 0.98
R7613:Usp53 UTSW 3 122949818 missense probably benign 0.43
R7621:Usp53 UTSW 3 122961285 missense probably benign 0.00
R7652:Usp53 UTSW 3 122953235 missense possibly damaging 0.80
R7753:Usp53 UTSW 3 122949238 missense probably damaging 1.00
R7859:Usp53 UTSW 3 122949766 missense possibly damaging 0.91
R7861:Usp53 UTSW 3 122934463 missense probably benign 0.26
R7911:Usp53 UTSW 3 122961267 missense probably benign 0.00
R7942:Usp53 UTSW 3 122949766 missense possibly damaging 0.91
R7944:Usp53 UTSW 3 122934463 missense probably benign 0.26
X0025:Usp53 UTSW 3 122957583 critical splice donor site probably null
Z1177:Usp53 UTSW 3 122953195 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTAATGTGTGTAAGTGTGCTCC -3'
(R):5'- TCTGCAAGATCAGGAACTTACTTCAC -3'

Sequencing Primer
(F):5'- GTGTAAGTGTGCTCCTAGCCTC -3'
(R):5'- GATCAGGAACTTACTTCACTTGTG -3'
Posted On2019-12-27