Incidental Mutation 'R0674:Rad51ap2'
ID61570
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
MMRRC Submission 038859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0674 (G1)
Quality Score141
Status Validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 11458817 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably null
Transcript: ENSMUST00000124065
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Meta Mutation Damage Score 0.9470 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5421:Rad51ap2 UTSW 12 11459367 nonsense probably null
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7916:Rad51ap2 UTSW 12 11456655 missense probably benign
R7922:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R8040:Rad51ap2 UTSW 12 11458791 missense probably benign 0.03
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GTTGAAACCAACACAAGAAATGCACCTT -3'
(R):5'- AGCTCTGTCTAGAGAAAGTGACTTGTCT -3'

Sequencing Primer
(F):5'- CAAGAAATGCACCTTTTTTGTCCTG -3'
(R):5'- agccaggcaatggttgtg -3'
Posted On2013-07-30