Mutagenetix > Incidental Mutation

Incidental Mutation 'R0674:Rimbp3'

61575

Institutional Source

Beutler Lab

Gene Symbol

Rimbp3

Ensembl Gene

ENSMUSG00000071636

Gene Name

RIMS binding protein 3

Synonyms

RIM-BP3, LOC239731, LOC385766

MMRRC Submission

038859-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.252) question?

Stock #

R0674 (G1)

Quality Score

126

Status

Validated

Chromosome

Chromosomal Location

17208603-17213982 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17212737 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1342 (S1342P)

Ref Sequence

ENSEMBL: ENSMUSP00000127909 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000169803]

AlphaFold

Q3V0F0

Predicted Effect

probably benign
Transcript: ENSMUST00000169803
AA Change: S1342P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)

SMART Domains

Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: S1342P

Domain	Start	End	E-Value	Type
coiled coil region	25	56	N/A	INTRINSIC
coiled coil region	84	145	N/A	INTRINSIC
low complexity region	308	324	N/A	INTRINSIC
coiled coil region	395	431	N/A	INTRINSIC
coiled coil region	547	610	N/A	INTRINSIC
low complexity region	688	701	N/A	INTRINSIC
low complexity region	769	780	N/A	INTRINSIC
SH3	825	888	7.58e-8	SMART
low complexity region	913	924	N/A	INTRINSIC
FN3	980	1052	2.21e-3	SMART
FN3	1073	1160	1.91e1	SMART
low complexity region	1236	1243	N/A	INTRINSIC
SH3	1423	1487	5.08e-2	SMART
SH3	1539	1602	5.97e-6	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.3%
20x: 90.4%

Validation Efficiency

97% (124/128)

MGI Phenotype

PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	A	3: 37,044,626	V1134E	possibly damaging	Het
Adar	A	G	3: 89,749,823		probably benign	Het
Adgrl2	A	T	3: 148,837,679	M803K	possibly damaging	Het
Atp13a5	T	C	16: 29,248,350		probably benign	Het
Atp2a3	T	C	11: 72,981,885	I753T	probably damaging	Het
Bace2	G	A	16: 97,436,749	V467M	possibly damaging	Het
Ccser2	A	G	14: 36,918,591	C11R	possibly damaging	Het
Cd2ap	T	A	17: 42,845,392	I85F	possibly damaging	Het
Cd2bp2	C	T	7: 127,194,836	E94K	probably damaging	Het
Chrna3	C	A	9: 55,015,172	A451S	probably damaging	Het
Cmya5	C	A	13: 93,092,791	V1930F	probably damaging	Het
Csmd1	T	C	8: 16,000,550	T2229A	probably benign	Het
Csrnp2	A	T	15: 100,487,991	L122H	probably damaging	Het
Cyp11b2	G	A	15: 74,855,544	P96L	probably damaging	Het
Ddr1	G	T	17: 35,689,669	S368*	probably null	Het
E2f1	T	C	2: 154,564,109	K115E	probably damaging	Het
Erlec1	A	T	11: 30,935,073		probably benign	Het
Fus	T	A	7: 127,972,776		probably benign	Het
Gml	G	A	15: 74,813,860	T92I	probably damaging	Het
Herc1	T	C	9: 66,501,192	S4567P	probably damaging	Het
Iglc2	A	G	16: 19,198,841	S5P	probably benign	Het
Itgam	T	C	7: 128,116,218	V1028A	possibly damaging	Het
Krt222	T	A	11: 99,236,260	N178I	probably benign	Het
Krt81	C	A	15: 101,463,627	R24L	possibly damaging	Het
Luzp1	C	T	4: 136,543,457	T997I	possibly damaging	Het
Maml1	G	T	11: 50,258,058	Q952K	probably benign	Het
Map2	A	G	1: 66,413,202	E499G	probably damaging	Het
Map4k4	A	T	1: 40,003,815	H118L	probably damaging	Het
Myzap	T	C	9: 71,515,144	D382G	probably damaging	Het
Naip5	T	C	13: 100,223,199	T510A	probably benign	Het
Nek6	G	C	2: 38,558,904	G95R	possibly damaging	Het
Nphp3	T	C	9: 104,036,282		probably null	Het
Nr1d2	T	C	14: 18,215,086	S309G	probably benign	Het
Nrcam	A	T	12: 44,564,322	I570F	probably benign	Het
Oas1d	T	C	5: 120,919,986	I331T	probably benign	Het
Olfr1306	A	T	2: 111,912,673	F86I	probably benign	Het
Olfr65	T	C	7: 103,907,255	V272A	probably benign	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Pex5l	A	T	3: 32,952,616	W535R	probably damaging	Het
Pisd	C	T	5: 32,774,437	R202H	probably benign	Het
Plxna2	A	G	1: 194,649,475	N403S	probably benign	Het
Prdm12	A	G	2: 31,643,912	I180M	probably benign	Het
Prpf6	A	G	2: 181,631,974	T304A	probably benign	Het
Ptprm	G	A	17: 67,191,341	T35I	possibly damaging	Het
Ptx3	T	A	3: 66,224,727	I223N	probably damaging	Het
Pygb	G	A	2: 150,815,134		probably null	Het
Qrsl1	A	G	10: 43,896,001		probably benign	Het
Rad51ap2	T	C	12: 11,458,817		probably null	Het
Ralbp1	C	T	17: 65,852,753	R505H	probably benign	Het
Slc22a14	C	A	9: 119,178,542	R267L	probably damaging	Het
Slco6c1	T	A	1: 97,104,773		probably benign	Het
Tcp1	T	C	17: 12,923,244	I375T	probably damaging	Het
Tiparp	T	C	3: 65,553,165	I525T	probably benign	Het
Tjp2	A	G	19: 24,131,316	L144P	probably benign	Het
Tssk2	A	G	16: 17,899,066	D111G	probably benign	Het
Ttn	T	C	2: 76,945,479	T1740A	possibly damaging	Het
Vmn2r102	T	A	17: 19,677,867	D381E	probably benign	Het
Vsig10	C	T	5: 117,343,846	T367M	probably damaging	Het
Wnt11	T	C	7: 98,846,528	C80R	probably damaging	Het
Zar1	T	A	5: 72,580,300		probably null	Het
Zfp52	A	T	17: 21,561,846	H652L	probably damaging	Het
Zpr1	T	A	9: 46,275,449	L194Q	probably damaging	Het

Other mutations in Rimbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Rimbp3	APN	16	17209743	missense	probably benign	0.01
IGL00786:Rimbp3	APN	16	17211688	missense	probably damaging	0.99
IGL01411:Rimbp3	APN	16	17211094	missense	probably damaging	1.00
IGL01434:Rimbp3	APN	16	17211702	missense	probably benign	0.13
IGL01895:Rimbp3	APN	16	17211436	missense	probably damaging	0.99
IGL02322:Rimbp3	APN	16	17211615	missense	probably benign	0.00
IGL02649:Rimbp3	APN	16	17209608	nonsense	probably null
IGL03285:Rimbp3	APN	16	17213232	missense	probably benign	0.16
PIT4581001:Rimbp3	UTSW	16	17210716	missense	possibly damaging	0.76
R0279:Rimbp3	UTSW	16	17209453	missense	probably benign	0.00
R0465:Rimbp3	UTSW	16	17211780	missense	possibly damaging	0.86
R0605:Rimbp3	UTSW	16	17211699	missense	probably damaging	0.99
R1676:Rimbp3	UTSW	16	17211113	missense	probably benign	0.13
R1780:Rimbp3	UTSW	16	17212632	missense	probably benign
R1946:Rimbp3	UTSW	16	17210427	missense	probably benign	0.10
R2113:Rimbp3	UTSW	16	17209675	missense	probably benign	0.00
R3847:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3849:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R3850:Rimbp3	UTSW	16	17210299	missense	probably benign	0.13
R4355:Rimbp3	UTSW	16	17209692	missense	possibly damaging	0.56
R4646:Rimbp3	UTSW	16	17213098	missense	probably damaging	0.99
R4669:Rimbp3	UTSW	16	17209189	missense	possibly damaging	0.88
R4732:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R4733:Rimbp3	UTSW	16	17210601	missense	possibly damaging	0.94
R5025:Rimbp3	UTSW	16	17209807	missense	probably damaging	0.99
R5039:Rimbp3	UTSW	16	17213331	missense	probably damaging	0.99
R5177:Rimbp3	UTSW	16	17209917	missense	possibly damaging	0.85
R5311:Rimbp3	UTSW	16	17210844	missense	probably benign	0.00
R5942:Rimbp3	UTSW	16	17211888	missense	probably benign	0.00
R6063:Rimbp3	UTSW	16	17210917	missense	probably damaging	1.00
R6092:Rimbp3	UTSW	16	17212270	missense	probably damaging	1.00
R6126:Rimbp3	UTSW	16	17212276	missense	probably benign	0.25
R6288:Rimbp3	UTSW	16	17212908	missense	probably benign	0.22
R6446:Rimbp3	UTSW	16	17212929	missense	probably benign	0.00
R6773:Rimbp3	UTSW	16	17209015	missense	probably damaging	1.00
R7017:Rimbp3	UTSW	16	17209746	missense	probably benign	0.04
R7043:Rimbp3	UTSW	16	17211108	missense	probably damaging	1.00
R7048:Rimbp3	UTSW	16	17210326	missense	probably benign	0.20
R7378:Rimbp3	UTSW	16	17211204	missense	probably benign
R7440:Rimbp3	UTSW	16	17213201	missense	possibly damaging	0.78
R7788:Rimbp3	UTSW	16	17212704	missense	probably benign	0.00
R7879:Rimbp3	UTSW	16	17211046	missense	possibly damaging	0.71
R8071:Rimbp3	UTSW	16	17210863	missense	probably benign
R8272:Rimbp3	UTSW	16	17209105	missense	possibly damaging	0.85
R8419:Rimbp3	UTSW	16	17213022	missense	probably damaging	0.97
R8819:Rimbp3	UTSW	16	17210907	missense	probably benign	0.17
R8830:Rimbp3	UTSW	16	17209006	missense	probably damaging	0.98
R8936:Rimbp3	UTSW	16	17213020	missense	probably benign
R8982:Rimbp3	UTSW	16	17209647	missense	probably benign	0.11
R9365:Rimbp3	UTSW	16	17208756	missense	possibly damaging	0.93
R9799:Rimbp3	UTSW	16	17209777	missense	possibly damaging	0.88
Z1176:Rimbp3	UTSW	16	17209474	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCCTTTCAGAAGAGTCCCCAGAACC -3'
(R):5'- GGAAGACCCTGACTGGATTGTTTGC -3'

Sequencing Primer
(F):5'- GGCCAGTCTGGGGTAGAG -3'
(R):5'- GGGCTACCACTTGTCATCTTAATG -3'

Posted On

2013-07-30