Incidental Mutation 'R0674:Cd2ap'
ID61580
Institutional Source Beutler Lab
Gene Symbol Cd2ap
Ensembl Gene ENSMUSG00000061665
Gene NameCD2-associated protein
SynonymsMets1, METS-1
MMRRC Submission 038859-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0674 (G1)
Quality Score160
Status Validated
Chromosome17
Chromosomal Location42792951-42876424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42845392 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 85 (I85F)
Ref Sequence ENSEMBL: ENSMUSP00000024709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024709]
PDB Structure
Third SH3 domain of CD2AP [SOLUTION NMR]
RDC refined solution structure of the first SH3 domain of CD2AP [SOLUTION NMR]
High resolution structure of the second SH3 domain of CD2AP [SOLUTION NMR]
RDC refined high resolution structure of the third SH3 domain of CD2AP [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by sh3 domains: molecular determinants and functional implications [SOLUTION NMR]
Distinct ubiquitin binding modes exhibited by SH3 domains: molecular determinants and functional implications [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024709
AA Change: I85F

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000024709
Gene: ENSMUSG00000061665
AA Change: I85F

DomainStartEndE-ValueType
SH3 2 58 4.48e-19 SMART
SH3 111 166 6.63e-22 SMART
low complexity region 183 195 N/A INTRINSIC
low complexity region 231 243 N/A INTRINSIC
SH3 272 329 4.62e-21 SMART
low complexity region 336 352 N/A INTRINSIC
low complexity region 377 399 N/A INTRINSIC
low complexity region 410 422 N/A INTRINSIC
PDB:3LK4|9 475 503 2e-12 PDB
low complexity region 536 555 N/A INTRINSIC
coiled coil region 595 635 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: This gene encodes a scaffolding molecule that regulates the actin cytoskeleton. The protein directly interacts with filamentous actin and a variety of cell membrane proteins through multiple actin binding sites, SH3 domains, and a proline-rich region containing binding sites for SH3 domains. The cytoplasmic protein localizes to membrane ruffles, lipid rafts, and the leading edges of cells. It is implicated in dynamic actin remodeling and membrane trafficking that occurs during receptor endocytosis and cytokinesis. The mouse genome contains at least two pseudogenes located on chromosomes 9 and 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired immune function and die at 6 to 7 weeks of age from kidney failure associated with podocyte defects and mesangial cell hyperplasia. Heterozygotes develop glomerular changes around 9 months. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Ralbp1 C T 17: 65,852,753 R505H probably benign Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Cd2ap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00674:Cd2ap APN 17 42808785 missense probably benign 0.16
IGL00909:Cd2ap APN 17 42830114 splice site probably benign
IGL01321:Cd2ap APN 17 42845389 missense possibly damaging 0.71
IGL01350:Cd2ap APN 17 42825921 nonsense probably null
IGL01485:Cd2ap APN 17 42852474 missense probably damaging 1.00
IGL01834:Cd2ap APN 17 42826360 critical splice acceptor site probably null
IGL01834:Cd2ap APN 17 42826361 critical splice acceptor site probably null
PIT4494001:Cd2ap UTSW 17 42852367 critical splice donor site probably null
R0014:Cd2ap UTSW 17 42807928 missense probably benign
R0331:Cd2ap UTSW 17 42805301 missense probably benign 0.06
R1471:Cd2ap UTSW 17 42820597 missense probably benign 0.00
R1806:Cd2ap UTSW 17 42838758 nonsense probably null
R3858:Cd2ap UTSW 17 42816572 nonsense probably null
R3911:Cd2ap UTSW 17 42816089 critical splice acceptor site probably null
R3941:Cd2ap UTSW 17 42808799 missense probably damaging 0.99
R4766:Cd2ap UTSW 17 42852459 missense probably damaging 0.99
R5024:Cd2ap UTSW 17 42805345 splice site probably null
R5045:Cd2ap UTSW 17 42807960 missense probably benign 0.01
R6051:Cd2ap UTSW 17 42796328 makesense probably null
R6063:Cd2ap UTSW 17 42825911 missense probably benign 0.00
R7034:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7036:Cd2ap UTSW 17 42798599 missense probably damaging 1.00
R7214:Cd2ap UTSW 17 42845394 missense possibly damaging 0.61
R7299:Cd2ap UTSW 17 42830013 nonsense probably null
R7301:Cd2ap UTSW 17 42830013 nonsense probably null
R7402:Cd2ap UTSW 17 42805163 missense possibly damaging 0.88
R7851:Cd2ap UTSW 17 42824472 critical splice donor site probably null
R7934:Cd2ap UTSW 17 42824472 critical splice donor site probably null
Z1088:Cd2ap UTSW 17 42807993 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCAGCACATCAGAGTTTCTGCAA -3'
(R):5'- GGCTGTGTCTTGGCATCTTACCTT -3'

Sequencing Primer
(F):5'- ATCAGAGTTTCTGCAACTGGC -3'
(R):5'- ctcaatagtagggatgctcagg -3'
Posted On2013-07-30