Incidental Mutation 'R0674:Ralbp1'
ID 61582
Institutional Source Beutler Lab
Gene Symbol Ralbp1
Ensembl Gene ENSMUSG00000024096
Gene Name ralA binding protein 1
Synonyms RLIP76, Rip1
MMRRC Submission 038859-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.791) question?
Stock # R0674 (G1)
Quality Score 112
Status Validated
Chromosome 17
Chromosomal Location 65848433-65885755 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65852753 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 505 (R505H)
Ref Sequence ENSEMBL: ENSMUSP00000129448 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024905] [ENSMUST00000166543]
AlphaFold Q62172
Predicted Effect probably benign
Transcript: ENSMUST00000024905
AA Change: R505H

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000024905
Gene: ENSMUSG00000024096
AA Change: R505H

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166543
AA Change: R505H

PolyPhen 2 Score 0.281 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129448
Gene: ENSMUSG00000024096
AA Change: R505H

DomainStartEndE-ValueType
low complexity region 63 80 N/A INTRINSIC
low complexity region 112 152 N/A INTRINSIC
low complexity region 159 180 N/A INTRINSIC
RhoGAP 207 373 1.04e-60 SMART
Blast:RhoGAP 391 493 1e-48 BLAST
low complexity region 533 551 N/A INTRINSIC
low complexity region 587 598 N/A INTRINSIC
low complexity region 602 621 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 90.4%
Validation Efficiency 97% (124/128)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RALBP1 plays a role in receptor-mediated endocytosis and is a downstream effector of the small GTP-binding protein RAL (see RALA; MIM 179550). Small G proteins, such as RAL, have GDP-bound inactive and GTP-bound active forms, which shift from the inactive to the active state through the action of RALGDS (MIM 601619), which in turn is activated by RAS (see HRAS; MIM 190020) (summary by Feig, 2003 [PubMed 12888294]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous and heterozygous null mice display increased sensitivity to X-ray irradiation, increased oxidative stress, and impaired glutathione homeostasis. Mice homozygous for a gene trap insertion exhibit decreases in exploratory and locomotor activity and a decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T A 3: 37,044,626 V1134E possibly damaging Het
Adar A G 3: 89,749,823 probably benign Het
Adgrl2 A T 3: 148,837,679 M803K possibly damaging Het
Atp13a5 T C 16: 29,248,350 probably benign Het
Atp2a3 T C 11: 72,981,885 I753T probably damaging Het
Bace2 G A 16: 97,436,749 V467M possibly damaging Het
Ccser2 A G 14: 36,918,591 C11R possibly damaging Het
Cd2ap T A 17: 42,845,392 I85F possibly damaging Het
Cd2bp2 C T 7: 127,194,836 E94K probably damaging Het
Chrna3 C A 9: 55,015,172 A451S probably damaging Het
Cmya5 C A 13: 93,092,791 V1930F probably damaging Het
Csmd1 T C 8: 16,000,550 T2229A probably benign Het
Csrnp2 A T 15: 100,487,991 L122H probably damaging Het
Cyp11b2 G A 15: 74,855,544 P96L probably damaging Het
Ddr1 G T 17: 35,689,669 S368* probably null Het
E2f1 T C 2: 154,564,109 K115E probably damaging Het
Erlec1 A T 11: 30,935,073 probably benign Het
Fus T A 7: 127,972,776 probably benign Het
Gml G A 15: 74,813,860 T92I probably damaging Het
Herc1 T C 9: 66,501,192 S4567P probably damaging Het
Iglc2 A G 16: 19,198,841 S5P probably benign Het
Itgam T C 7: 128,116,218 V1028A possibly damaging Het
Krt222 T A 11: 99,236,260 N178I probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Luzp1 C T 4: 136,543,457 T997I possibly damaging Het
Maml1 G T 11: 50,258,058 Q952K probably benign Het
Map2 A G 1: 66,413,202 E499G probably damaging Het
Map4k4 A T 1: 40,003,815 H118L probably damaging Het
Myzap T C 9: 71,515,144 D382G probably damaging Het
Naip5 T C 13: 100,223,199 T510A probably benign Het
Nek6 G C 2: 38,558,904 G95R possibly damaging Het
Nphp3 T C 9: 104,036,282 probably null Het
Nr1d2 T C 14: 18,215,086 S309G probably benign Het
Nrcam A T 12: 44,564,322 I570F probably benign Het
Oas1d T C 5: 120,919,986 I331T probably benign Het
Olfr1306 A T 2: 111,912,673 F86I probably benign Het
Olfr65 T C 7: 103,907,255 V272A probably benign Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pex5l A T 3: 32,952,616 W535R probably damaging Het
Pisd C T 5: 32,774,437 R202H probably benign Het
Plxna2 A G 1: 194,649,475 N403S probably benign Het
Prdm12 A G 2: 31,643,912 I180M probably benign Het
Prpf6 A G 2: 181,631,974 T304A probably benign Het
Ptprm G A 17: 67,191,341 T35I possibly damaging Het
Ptx3 T A 3: 66,224,727 I223N probably damaging Het
Pygb G A 2: 150,815,134 probably null Het
Qrsl1 A G 10: 43,896,001 probably benign Het
Rad51ap2 T C 12: 11,458,817 probably null Het
Rimbp3 T C 16: 17,212,737 S1342P probably benign Het
Slc22a14 C A 9: 119,178,542 R267L probably damaging Het
Slco6c1 T A 1: 97,104,773 probably benign Het
Tcp1 T C 17: 12,923,244 I375T probably damaging Het
Tiparp T C 3: 65,553,165 I525T probably benign Het
Tjp2 A G 19: 24,131,316 L144P probably benign Het
Tssk2 A G 16: 17,899,066 D111G probably benign Het
Ttn T C 2: 76,945,479 T1740A possibly damaging Het
Vmn2r102 T A 17: 19,677,867 D381E probably benign Het
Vsig10 C T 5: 117,343,846 T367M probably damaging Het
Wnt11 T C 7: 98,846,528 C80R probably damaging Het
Zar1 T A 5: 72,580,300 probably null Het
Zfp52 A T 17: 21,561,846 H652L probably damaging Het
Zpr1 T A 9: 46,275,449 L194Q probably damaging Het
Other mutations in Ralbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ralbp1 APN 17 65864612 missense possibly damaging 0.87
IGL00736:Ralbp1 APN 17 65864723 missense probably damaging 1.00
IGL01318:Ralbp1 APN 17 65864282 missense probably damaging 1.00
IGL01661:Ralbp1 APN 17 65861389 missense probably damaging 0.99
IGL02523:Ralbp1 APN 17 65859091 missense probably damaging 0.99
R0507:Ralbp1 UTSW 17 65849960 missense probably benign 0.08
R0666:Ralbp1 UTSW 17 65854129 missense probably benign 0.28
R1418:Ralbp1 UTSW 17 65859148 splice site probably benign
R2136:Ralbp1 UTSW 17 65864666 missense probably damaging 1.00
R2320:Ralbp1 UTSW 17 65852747 missense possibly damaging 0.71
R4657:Ralbp1 UTSW 17 65852691 missense probably null 0.99
R5482:Ralbp1 UTSW 17 65861568 nonsense probably null
R5545:Ralbp1 UTSW 17 65850104 missense possibly damaging 0.77
R5967:Ralbp1 UTSW 17 65864279 missense probably benign 0.19
R6512:Ralbp1 UTSW 17 65861275 missense probably damaging 1.00
R6853:Ralbp1 UTSW 17 65852756 missense possibly damaging 0.86
R7399:Ralbp1 UTSW 17 65854148 missense probably benign 0.01
R7423:Ralbp1 UTSW 17 65858981 missense probably damaging 0.99
R7545:Ralbp1 UTSW 17 65867598 missense probably benign
R8394:Ralbp1 UTSW 17 65852753 missense probably benign 0.28
R8755:Ralbp1 UTSW 17 65859041 missense possibly damaging 0.91
R9425:Ralbp1 UTSW 17 65864511 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGCTGCCTAAGACCCAGTAAGGAG -3'
(R):5'- TCATGGGAGCCTTGCAGAAGCTAC -3'

Sequencing Primer
(F):5'- gatgccaaacaaccctttcc -3'
(R):5'- CTCAACGTGACTTGGTGTAGC -3'
Posted On 2013-07-30