Incidental Mutation 'R7994:Syt1'
ID615849
Institutional Source Beutler Lab
Gene Symbol Syt1
Ensembl Gene ENSMUSG00000035864
Gene Namesynaptotagmin I
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7994 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location108497650-109010982 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108642248 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 105 (D105G)
Ref Sequence ENSEMBL: ENSMUSP00000063293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064054] [ENSMUST00000105276]
Predicted Effect probably benign
Transcript: ENSMUST00000064054
AA Change: D105G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000063293
Gene: ENSMUSG00000035864
AA Change: D105G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.8e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105276
AA Change: D105G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000100912
Gene: ENSMUSG00000035864
AA Change: D105G

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
PDB:4ISQ|F 32 52 1e-5 PDB
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 131 141 N/A INTRINSIC
C2 157 259 3.2e-25 SMART
C2 288 402 5.9e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The synaptotagmins are integral membrane proteins of synaptic vesicles thought to serve as Ca(2+) sensors in the process of vesicular trafficking and exocytosis. Calcium binding to synaptotagmin-1 participates in triggering neurotransmitter release at the synapse (Fernandez-Chacon et al., 2001 [PubMed 11242035]).[supplied by OMIM, Jul 2010]
PHENOTYPE: Homozygous null mice do not suckle, show impaired synaptic transmission and Ca2+-evoked neurotransmitter release, and die by 48 hrs of life. Knock-in mice bearing a missense mutation show enhanced synaptic depression while those carrying a point mutationshow reduced synaptic release probability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCT GTCACTGGTTCTCTGATCACTGGTTCT 3: 95,888,151 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hivep1 T A 13: 42,156,366 M694K probably benign Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Syt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01793:Syt1 APN 10 108583975 missense possibly damaging 0.49
R1067:Syt1 UTSW 10 108636662 missense probably benign
R1300:Syt1 UTSW 10 108631821 missense possibly damaging 0.95
R1370:Syt1 UTSW 10 108690922 missense probably damaging 0.98
R1575:Syt1 UTSW 10 108504500 missense probably benign 0.04
R1656:Syt1 UTSW 10 108583915 missense probably damaging 1.00
R2072:Syt1 UTSW 10 108583972 missense probably damaging 1.00
R2212:Syt1 UTSW 10 108504414 missense possibly damaging 0.89
R2429:Syt1 UTSW 10 108690920 missense possibly damaging 0.86
R4928:Syt1 UTSW 10 108504512 missense possibly damaging 0.95
R5216:Syt1 UTSW 10 108642257 missense probably benign 0.00
R6161:Syt1 UTSW 10 108631807 missense probably damaging 1.00
R6193:Syt1 UTSW 10 108500736 missense probably benign 0.38
R7033:Syt1 UTSW 10 108690936 missense probably benign
R7535:Syt1 UTSW 10 108627422 critical splice acceptor site probably null
R7574:Syt1 UTSW 10 108504401 missense probably damaging 1.00
R7913:Syt1 UTSW 10 108642248 missense probably benign 0.00
R8003:Syt1 UTSW 10 108636573 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCACTACACTTTGGGAGAC -3'
(R):5'- AACTGGTCCACTGCTGATGTTC -3'

Sequencing Primer
(F):5'- TCATACCTGAAGGGACCGC -3'
(R):5'- GTCCACTGCTGATGTTCCGTTTC -3'
Posted On2019-12-27