Incidental Mutation 'R7994:Hivep1'
ID615858
Institutional Source Beutler Lab
Gene Symbol Hivep1
Ensembl Gene ENSMUSG00000021366
Gene Namehuman immunodeficiency virus type I enhancer binding protein 1
SynonymsCryabp1, alphaA-CRYBP1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R7994 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location42052021-42192537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 42156366 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 694 (M694K)
Ref Sequence ENSEMBL: ENSMUSP00000056147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060148] [ENSMUST00000220525]
Predicted Effect probably benign
Transcript: ENSMUST00000060148
AA Change: M694K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000056147
Gene: ENSMUSG00000021366
AA Change: M694K

DomainStartEndE-ValueType
coiled coil region 10 36 N/A INTRINSIC
low complexity region 177 194 N/A INTRINSIC
low complexity region 355 371 N/A INTRINSIC
low complexity region 376 388 N/A INTRINSIC
ZnF_C2H2 407 429 4.79e-3 SMART
ZnF_C2H2 435 457 1.95e-3 SMART
low complexity region 488 504 N/A INTRINSIC
low complexity region 595 609 N/A INTRINSIC
low complexity region 844 854 N/A INTRINSIC
ZnF_C2H2 953 980 1.53e2 SMART
low complexity region 1253 1271 N/A INTRINSIC
low complexity region 1275 1307 N/A INTRINSIC
low complexity region 1585 1608 N/A INTRINSIC
low complexity region 1902 1912 N/A INTRINSIC
ZnF_C2H2 2074 2096 2.24e-3 SMART
ZnF_C2H2 2102 2126 1.5e-4 SMART
low complexity region 2164 2183 N/A INTRINSIC
low complexity region 2299 2313 N/A INTRINSIC
low complexity region 2345 2365 N/A INTRINSIC
low complexity region 2517 2527 N/A INTRINSIC
low complexity region 2580 2594 N/A INTRINSIC
low complexity region 2629 2642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220525
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor belonging to the ZAS family, members of which are large proteins that contain a ZAS domain - a modular protein structure consisting of a pair of C2H2 zinc fingers with an acidic-rich region and a serine/threonine-rich sequence. These proteins bind specifically to the DNA sequence motif, GGGACTTTCC, found in the enhancer elements of several viral promoters, including human immunodeficiency virus (HIV), and to related sequences found in the enhancer elements of a number of cellular promoters. This protein binds to this sequence motif, suggesting a role in the transcriptional regulation of both viral and cellular genes. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apaf1 A G 10: 91,060,271 V324A probably damaging Het
Aqp8 T A 7: 123,464,272 I115N possibly damaging Het
Atrn G A 2: 130,970,211 C692Y probably damaging Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
BC028528 GTCACTGGTTCT GTCACTGGTTCTCTGATCACTGGTTCT 3: 95,888,151 probably benign Het
BC028528 TCTGTGGTCACTGGT TCTGTGGTCACTGGTGCTGTGGTCACTGGT 3: 95,888,175 probably benign Het
Card10 A T 15: 78,781,103 S717T possibly damaging Het
Cep78 T C 19: 15,970,577 S408G probably benign Het
Col24a1 G T 3: 145,431,866 G895* probably null Het
Cs A T 10: 128,350,441 K34N possibly damaging Het
Dchs1 T C 7: 105,759,228 E1799G possibly damaging Het
Dlg5 A T 14: 24,137,124 probably null Het
Dpy19l4 A T 4: 11,265,859 Y696* probably null Het
Dync1h1 A T 12: 110,628,734 N1360I probably benign Het
Fgd2 G T 17: 29,374,045 R423L probably damaging Het
Fmo4 T C 1: 162,794,172 D490G possibly damaging Het
Gm13083 T A 4: 143,615,045 Y15N possibly damaging Het
Grid1 T A 14: 35,569,697 W854R probably damaging Het
H2-M1 T C 17: 36,670,237 probably null Het
Hsd17b6 T C 10: 127,997,776 T79A possibly damaging Het
Hspa4 A C 11: 53,262,307 V761G probably benign Het
Ifi203 T C 1: 173,926,957 Y736C probably damaging Het
Mettl9 T A 7: 121,076,301 L308Q probably damaging Het
Miox A G 15: 89,336,582 D230G probably damaging Het
Ncapd3 T A 9: 27,048,226 C319* probably null Het
Ncs1 C A 2: 31,287,284 probably null Het
Nell1 T A 7: 50,279,522 H392Q possibly damaging Het
Nlrp1b C A 11: 71,217,711 E321D possibly damaging Het
Nlrp9b A T 7: 20,045,800 H796L probably benign Het
Nudt16l1 C A 16: 4,939,381 Q53K possibly damaging Het
Nyap1 A G 5: 137,734,969 S601P probably damaging Het
Odf2l C T 3: 145,153,483 Q634* probably null Het
Olfr1023 T A 2: 85,887,730 L310H probably damaging Het
Olfr1150-ps1 A G 2: 87,846,693 I141V probably benign Het
Olfr118 A T 17: 37,672,108 E28D probably benign Het
Olfr1477 T A 19: 13,503,207 V288E probably damaging Het
Olfr381 A G 11: 73,486,398 V142A probably benign Het
Pik3c2b T C 1: 133,090,061 probably null Het
Prl3c1 A G 13: 27,199,410 I40V probably benign Het
R3hdm4 C T 10: 79,911,945 A229T probably damaging Het
Rab3gap2 T C 1: 185,262,816 S851P possibly damaging Het
Ralgapb A T 2: 158,465,939 I1056F probably damaging Het
Sec16b T C 1: 157,529,329 Y36H probably benign Het
Setd3 A T 12: 108,107,665 V451D probably benign Het
Slc35e1 T C 8: 72,484,662 K334R probably damaging Het
Synj1 A T 16: 90,991,427 N184K possibly damaging Het
Syt1 T C 10: 108,642,248 D105G probably benign Het
Taar7e T A 10: 24,038,004 C131S possibly damaging Het
Tead4 A G 6: 128,243,368 probably null Het
Tescl C A 7: 24,333,651 R83L probably damaging Het
Ufd1 G T 16: 18,814,866 V14F probably benign Het
Ugt1a10 T A 1: 88,055,755 Y92N probably benign Het
Vmn2r52 C A 7: 10,162,950 V532L probably benign Het
Vmn2r67 G A 7: 85,151,828 T300I possibly damaging Het
Wt1 T G 2: 105,166,860 S381A probably damaging Het
Zbtb44 C T 9: 31,054,208 Q305* probably null Het
Other mutations in Hivep1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Hivep1 APN 13 42154649 missense probably benign 0.00
IGL00572:Hivep1 APN 13 42158871 missense probably benign 0.00
IGL00820:Hivep1 APN 13 42183818 missense probably benign 0.29
IGL00846:Hivep1 APN 13 42167616 nonsense probably null
IGL01068:Hivep1 APN 13 42159984 missense probably benign 0.00
IGL01431:Hivep1 APN 13 42158017 missense probably damaging 0.96
IGL01664:Hivep1 APN 13 42159279 missense probably benign 0.18
IGL01833:Hivep1 APN 13 42154988 nonsense probably null
IGL02037:Hivep1 APN 13 42156077 missense probably benign 0.00
IGL02375:Hivep1 APN 13 42156449 missense probably benign 0.30
IGL02414:Hivep1 APN 13 42154909 missense probably damaging 0.99
IGL02609:Hivep1 APN 13 42155654 missense probably damaging 0.98
IGL02649:Hivep1 APN 13 42157311 missense possibly damaging 0.69
IGL02654:Hivep1 APN 13 42157685 missense probably damaging 0.97
IGL02977:Hivep1 APN 13 42155936 missense possibly damaging 0.94
IGL03124:Hivep1 APN 13 42158904 missense possibly damaging 0.66
IGL03050:Hivep1 UTSW 13 42156128 missense probably benign 0.12
PIT4305001:Hivep1 UTSW 13 42181671 missense
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0067:Hivep1 UTSW 13 42158656 missense probably benign 0.00
R0078:Hivep1 UTSW 13 42156041 missense probably damaging 1.00
R0194:Hivep1 UTSW 13 42155435 missense probably damaging 1.00
R0195:Hivep1 UTSW 13 42156153 missense probably benign
R0245:Hivep1 UTSW 13 42164290 missense possibly damaging 0.93
R0348:Hivep1 UTSW 13 42158379 missense possibly damaging 0.65
R0654:Hivep1 UTSW 13 42159756 missense probably benign 0.16
R0655:Hivep1 UTSW 13 42167585 missense probably damaging 1.00
R0717:Hivep1 UTSW 13 42154946 missense possibly damaging 0.46
R1013:Hivep1 UTSW 13 42156962 missense probably damaging 1.00
R1216:Hivep1 UTSW 13 42157521 missense probably benign 0.03
R1256:Hivep1 UTSW 13 42181831 missense probably damaging 1.00
R1435:Hivep1 UTSW 13 42158043 missense probably damaging 1.00
R1437:Hivep1 UTSW 13 42157140 missense probably benign 0.03
R1438:Hivep1 UTSW 13 42158120 missense probably benign 0.00
R1672:Hivep1 UTSW 13 42160284 missense probably damaging 0.96
R1733:Hivep1 UTSW 13 42157931 missense probably damaging 1.00
R1762:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1786:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R1909:Hivep1 UTSW 13 42155646 missense probably benign 0.38
R1993:Hivep1 UTSW 13 42157493 missense probably benign 0.00
R2004:Hivep1 UTSW 13 42160149 missense possibly damaging 0.47
R2061:Hivep1 UTSW 13 42160124 missense possibly damaging 0.80
R2069:Hivep1 UTSW 13 42183786 missense possibly damaging 0.80
R2075:Hivep1 UTSW 13 42156318 missense probably damaging 0.98
R2076:Hivep1 UTSW 13 42164393 critical splice donor site probably null
R2085:Hivep1 UTSW 13 42183750 missense probably benign 0.34
R3701:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3702:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3716:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3718:Hivep1 UTSW 13 42158495 missense probably damaging 1.00
R3719:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R3720:Hivep1 UTSW 13 42158601 missense probably benign 0.01
R3820:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3822:Hivep1 UTSW 13 42184311 missense possibly damaging 0.46
R3842:Hivep1 UTSW 13 42157727 missense probably benign 0.03
R4379:Hivep1 UTSW 13 42155430 missense probably damaging 1.00
R4525:Hivep1 UTSW 13 42155813 missense probably benign
R4587:Hivep1 UTSW 13 42156228 missense probably benign 0.00
R4604:Hivep1 UTSW 13 42159749 missense probably benign 0.08
R4686:Hivep1 UTSW 13 42155850 missense probably benign 0.00
R4725:Hivep1 UTSW 13 42163411 missense probably benign 0.19
R4924:Hivep1 UTSW 13 42158316 missense probably benign 0.20
R5009:Hivep1 UTSW 13 42158753 missense probably benign 0.06
R5320:Hivep1 UTSW 13 42159639 missense probably damaging 1.00
R5385:Hivep1 UTSW 13 42164395 splice site probably null
R5498:Hivep1 UTSW 13 42123158 critical splice acceptor site probably null
R5521:Hivep1 UTSW 13 42158328 missense probably damaging 1.00
R5529:Hivep1 UTSW 13 42156650 missense possibly damaging 0.81
R5584:Hivep1 UTSW 13 42160117 missense probably benign
R5635:Hivep1 UTSW 13 42160127 missense probably benign 0.16
R5636:Hivep1 UTSW 13 42163456 missense possibly damaging 0.92
R5886:Hivep1 UTSW 13 42156612 missense probably damaging 1.00
R5895:Hivep1 UTSW 13 42157218 missense possibly damaging 0.95
R5981:Hivep1 UTSW 13 42160188 missense probably damaging 1.00
R6012:Hivep1 UTSW 13 42184458 missense possibly damaging 0.50
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6033:Hivep1 UTSW 13 42157107 missense probably benign 0.20
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6037:Hivep1 UTSW 13 42157940 missense probably damaging 1.00
R6241:Hivep1 UTSW 13 42158370 missense probably benign 0.01
R6247:Hivep1 UTSW 13 42157490 missense probably benign
R6343:Hivep1 UTSW 13 42159671 nonsense probably null
R6631:Hivep1 UTSW 13 42156480 missense probably damaging 0.96
R6720:Hivep1 UTSW 13 42164284 missense probably damaging 1.00
R6767:Hivep1 UTSW 13 42154727 missense probably damaging 0.99
R6797:Hivep1 UTSW 13 42157081 missense probably benign 0.00
R6800:Hivep1 UTSW 13 42157376 missense probably damaging 1.00
R6854:Hivep1 UTSW 13 42156507 missense probably damaging 1.00
R6919:Hivep1 UTSW 13 42183452 missense probably benign 0.00
R6993:Hivep1 UTSW 13 42158714 missense possibly damaging 0.94
R7104:Hivep1 UTSW 13 42157338 missense probably benign 0.26
R7139:Hivep1 UTSW 13 42159954 missense probably benign 0.28
R7186:Hivep1 UTSW 13 42156338 missense probably benign 0.01
R7227:Hivep1 UTSW 13 42156911 missense probably benign 0.02
R7263:Hivep1 UTSW 13 42158192 missense possibly damaging 0.50
R7438:Hivep1 UTSW 13 42154911 missense probably damaging 0.99
R7490:Hivep1 UTSW 13 42157650 missense probably damaging 1.00
R7583:Hivep1 UTSW 13 42164240 missense probably damaging 1.00
R7708:Hivep1 UTSW 13 42164277 nonsense probably null
R7763:Hivep1 UTSW 13 42159461 missense probably benign 0.12
R7840:Hivep1 UTSW 13 42155352 missense probably benign
R7864:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R7913:Hivep1 UTSW 13 42156366 missense probably benign 0.00
R7923:Hivep1 UTSW 13 42155352 missense probably benign
R7947:Hivep1 UTSW 13 42158814 missense probably benign 0.02
R8017:Hivep1 UTSW 13 42167622 missense
R8019:Hivep1 UTSW 13 42167622 missense
X0060:Hivep1 UTSW 13 42154985 missense probably benign 0.07
X0067:Hivep1 UTSW 13 42156717 missense probably damaging 0.98
Z1177:Hivep1 UTSW 13 42159981 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AGGGAAGCCAGATTCTCACAG -3'
(R):5'- CCAGTTGCTTATCATCAACCAAGG -3'

Sequencing Primer
(F):5'- GATTCTCACAGTGGAACAGCACATG -3'
(R):5'- CCAAGGCTTCATTGTCTGAGATCAG -3'
Posted On2019-12-27