Mutagenetix > Incidental Mutation

Incidental Mutation 'R0675:Rif1'

61587

Institutional Source

Beutler Lab

Gene Symbol

Rif1

Ensembl Gene

ENSMUSG00000036202

Gene Name

replication timing regulatory factor 1

Synonyms

6530403D07Rik, 5730435J01Rik, D2Ertd145e

MMRRC Submission

038860-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0675 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

52072832-52122383 bp(+) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

GCCACCA to GCCA at 52110324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000069794
AA Change: 1264

SMART Domains

Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: 1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	22	368	3.3e-78	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112693
AA Change: P1264

SMART Domains

Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: P1264

Domain	Start	End	E-Value	Type
Pfam:Rif1_N	18	381	1.4e-85	PFAM
low complexity region	432	444	N/A	INTRINSIC
low complexity region	586	598	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1180	1205	N/A	INTRINSIC
low complexity region	1310	1321	N/A	INTRINSIC
low complexity region	1423	1446	N/A	INTRINSIC
low complexity region	1576	1586	N/A	INTRINSIC
low complexity region	1677	1690	N/A	INTRINSIC
low complexity region	1702	1712	N/A	INTRINSIC
low complexity region	2176	2195	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000125322

Predicted Effect

probably benign
Transcript: ENSMUST00000125376

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145130

Predicted Effect

probably benign
Transcript: ENSMUST00000152178

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.7%
20x: 96.1%

Validation Efficiency

97% (88/91)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001C19Rik	T	C	17: 47,413,776	E140G	probably benign	Het
4932431P20Rik	T	C	7: 29,532,517		noncoding transcript	Het
Ablim2	C	T	5: 35,866,780		probably benign	Het
Aire	T	C	10: 78,034,493		probably benign	Het
Akap12	T	C	10: 4,353,315	S42P	probably benign	Het
Amigo1	T	C	3: 108,191,669		probably benign	Het
Angptl3	A	G	4: 99,033,262	T206A	probably benign	Het
Ank1	T	A	8: 23,110,384		probably benign	Het
Ano5	A	T	7: 51,574,810	T472S	probably damaging	Het
Arid3c	T	C	4: 41,725,958	D215G	probably damaging	Het
Cd200	T	C	16: 45,397,110	I73V	probably benign	Het
Cd47	T	C	16: 49,906,799	I318T	possibly damaging	Het
Cep290	A	G	10: 100,568,813		probably null	Het
Cep350	A	G	1: 155,959,753	S66P	possibly damaging	Het
Cfap46	C	T	7: 139,676,034	C300Y	probably damaging	Het
Chd1	T	A	17: 15,758,261		probably benign	Het
Chd5	C	A	4: 152,385,950	T1913K	probably benign	Het
Clec4b1	A	G	6: 123,071,446	Y180C	probably damaging	Het
Cntnap5c	A	T	17: 58,034,995	D227V	probably damaging	Het
Col19a1	C	G	1: 24,575,455		probably benign	Het
Csmd1	A	T	8: 16,158,131	M1270K	probably benign	Het
Cyp2c66	T	A	19: 39,186,616	F487I	possibly damaging	Het
Dpp8	T	C	9: 65,066,502		probably benign	Het
Duoxa1	A	T	2: 122,306,380		probably benign	Het
Edil3	A	G	13: 89,177,280	K263E	probably damaging	Het
Fat2	A	G	11: 55,309,209	L1013P	probably damaging	Het
Fras1	T	C	5: 96,667,387		probably benign	Het
Gab1	A	G	8: 80,769,668	S668P	probably damaging	Het
Galnt14	T	C	17: 73,545,035	T130A	probably damaging	Het
Gm10192	G	A	4: 97,182,872	H99Y	unknown	Het
Gm5592	A	G	7: 41,289,387	T698A	possibly damaging	Het
Gm6605	C	A	7: 38,448,275		noncoding transcript	Het
Gsdma3	A	G	11: 98,631,191	K149R	probably benign	Het
Igkv4-71	A	G	6: 69,243,427	S29P	probably damaging	Het
Igsf10	C	T	3: 59,328,594	V1389I	probably benign	Het
Ik	T	C	18: 36,747,333		probably benign	Het
Ino80	G	A	2: 119,383,481	P1203S	probably damaging	Het
Iqsec2	G	A	X: 152,204,124	E398K	possibly damaging	Het
Jmjd6	A	G	11: 116,840,527	V232A	probably damaging	Het
Klhdc9	G	A	1: 171,360,327	T112M	possibly damaging	Het
Marcks	A	G	10: 37,141,185		probably benign	Het
Mctp2	T	A	7: 72,083,170	T829S	probably damaging	Het
Mroh2a	C	A	1: 88,228,380	A78E	probably damaging	Het
Mroh2a	G	A	1: 88,250,342	D1053N	probably damaging	Het
Mtmr14	A	T	6: 113,270,647	H518L	probably damaging	Het
Mum1	T	A	10: 80,230,080	V56E	probably damaging	Het
Myo5c	T	C	9: 75,278,289	M978T	probably benign	Het
Nlrc3	T	C	16: 3,948,911	I1015V	probably benign	Het
Nlrp5	C	A	7: 23,417,417	Q189K	possibly damaging	Het
Olfr1082	T	C	2: 86,594,079	I250V	probably benign	Het
Olfr385	A	C	11: 73,589,252	L162R	probably damaging	Het
Olfr583	A	G	7: 103,051,702	I135V	probably benign	Het
Olfr92	G	C	17: 37,111,455	L176V	probably benign	Het
Otof	T	A	5: 30,382,361	Y1051F	probably benign	Het
Pcdhb14	C	A	18: 37,448,339	T166K	possibly damaging	Het
Pla2g4e	A	G	2: 120,200,198		probably benign	Het
Polr3gl	T	C	3: 96,582,155	E20G	probably damaging	Het
Psmd1	A	G	1: 86,082,039	D295G	probably benign	Het
Ptpn21	C	A	12: 98,688,216	A831S	probably benign	Het
Rd3l	T	C	12: 111,980,162	D60G	probably benign	Het
Rnf213	A	G	11: 119,441,834	D2624G	probably benign	Het
Sec31a	T	C	5: 100,393,207	D347G	probably damaging	Het
Sema4g	G	A	19: 44,997,587	R289H	probably damaging	Het
Sema5b	C	T	16: 35,660,333	T761I	probably benign	Het
Sept1	A	T	7: 127,216,999	F86L	probably damaging	Het
Shank3	T	C	15: 89,531,388	V627A	possibly damaging	Het
Slc25a46	C	A	18: 31,609,588	G75V	probably benign	Het
Slc45a2	T	A	15: 11,025,778	Y405N	probably damaging	Het
Spidr	T	C	16: 16,037,634	E339G	probably damaging	Het
Sptbn1	A	T	11: 30,117,903	H1770Q	probably damaging	Het
Srgap1	T	C	10: 121,792,235	Y944C	probably damaging	Het
Supt20	C	T	3: 54,706,969	T169I	probably damaging	Het
Tie1	G	A	4: 118,479,769	Q587*	probably null	Het
Tmem214	A	G	5: 30,871,825	T203A	possibly damaging	Het
Tmprss15	C	A	16: 78,985,950	S742I	probably damaging	Het
Zfhx2	A	G	14: 55,063,163	V2377A	probably damaging	Het
Zfp763	G	A	17: 33,019,800	H124Y	possibly damaging	Het
Zfp846	T	C	9: 20,593,557	S238P	probably benign	Het

Other mutations in Rif1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00465:Rif1	APN	2	52121007	missense	probably damaging	0.96
IGL00711:Rif1	APN	2	52111070	missense	probably benign	0.00
IGL00721:Rif1	APN	2	52119117	missense	probably damaging	1.00
IGL01085:Rif1	APN	2	52085140	missense	possibly damaging	0.71
IGL01093:Rif1	APN	2	52095948	missense	probably damaging	1.00
IGL01107:Rif1	APN	2	52111303	missense	probably benign	0.00
IGL01138:Rif1	APN	2	52111522	missense	probably damaging	1.00
IGL01844:Rif1	APN	2	52112543	missense	probably benign	0.07
IGL02441:Rif1	APN	2	52105515	missense	probably benign	0.00
IGL02448:Rif1	APN	2	52116696	missense	probably damaging	0.99
IGL02563:Rif1	APN	2	52077065	missense	probably damaging	1.00
IGL02704:Rif1	APN	2	52093576	missense	probably damaging	1.00
IGL02946:Rif1	APN	2	52110125	nonsense	probably null
IGL03060:Rif1	APN	2	52112137	missense	probably damaging	0.97
IGL03206:Rif1	APN	2	52103622	missense	probably damaging	1.00
IGL03263:Rif1	APN	2	52090261	missense	probably damaging	0.99
IGL03267:Rif1	APN	2	52076988	missense	possibly damaging	0.94
IGL03280:Rif1	APN	2	52112599	missense	probably benign	0.32
hifi	UTSW	2	52110324	unclassified	probably benign
nietzsche	UTSW	2	52077020	missense	probably benign	0.08
PIT4305001:Rif1	UTSW	2	52111958	missense
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0017:Rif1	UTSW	2	52116674	missense	probably benign	0.18
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0060:Rif1	UTSW	2	52111117	missense	probably damaging	1.00
R0104:Rif1	UTSW	2	52110092	missense	possibly damaging	0.77
R0268:Rif1	UTSW	2	52090286	critical splice donor site	probably null
R0276:Rif1	UTSW	2	52110324	unclassified	probably benign
R0278:Rif1	UTSW	2	52110324	unclassified	probably benign
R0288:Rif1	UTSW	2	52110013	missense	probably damaging	1.00
R0314:Rif1	UTSW	2	52110324	unclassified	probably benign
R0345:Rif1	UTSW	2	52110324	unclassified	probably benign
R0346:Rif1	UTSW	2	52110324	unclassified	probably benign
R0383:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R0384:Rif1	UTSW	2	52110324	unclassified	probably benign
R0387:Rif1	UTSW	2	52110324	unclassified	probably benign
R0388:Rif1	UTSW	2	52110324	unclassified	probably benign
R0456:Rif1	UTSW	2	52110324	unclassified	probably benign
R0477:Rif1	UTSW	2	52110324	unclassified	probably benign
R0505:Rif1	UTSW	2	52110737	missense	probably damaging	0.99
R0510:Rif1	UTSW	2	52110324	unclassified	probably benign
R0511:Rif1	UTSW	2	52110324	unclassified	probably benign
R0512:Rif1	UTSW	2	52110324	unclassified	probably benign
R0633:Rif1	UTSW	2	52112563	missense	probably benign	0.00
R0637:Rif1	UTSW	2	52110324	unclassified	probably benign
R0638:Rif1	UTSW	2	52111588	missense	probably benign	0.12
R0666:Rif1	UTSW	2	52110324	unclassified	probably benign
R0707:Rif1	UTSW	2	52110324	unclassified	probably benign
R0726:Rif1	UTSW	2	52110353	missense	possibly damaging	0.52
R0743:Rif1	UTSW	2	52110324	unclassified	probably benign
R0744:Rif1	UTSW	2	52110324	unclassified	probably benign
R0938:Rif1	UTSW	2	52110324	unclassified	probably benign
R0939:Rif1	UTSW	2	52110324	unclassified	probably benign
R0940:Rif1	UTSW	2	52110324	unclassified	probably benign
R0941:Rif1	UTSW	2	52110324	unclassified	probably benign
R0942:Rif1	UTSW	2	52110324	unclassified	probably benign
R0943:Rif1	UTSW	2	52110324	unclassified	probably benign
R1006:Rif1	UTSW	2	52085029	missense	probably damaging	0.99
R1052:Rif1	UTSW	2	52111562	missense	probably benign	0.01
R1061:Rif1	UTSW	2	52110324	unclassified	probably benign
R1175:Rif1	UTSW	2	52107628	unclassified	probably benign
R1183:Rif1	UTSW	2	52110324	unclassified	probably benign
R1184:Rif1	UTSW	2	52110324	unclassified	probably benign
R1271:Rif1	UTSW	2	52110324	unclassified	probably benign
R1332:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1336:Rif1	UTSW	2	52078314	missense	probably benign	0.06
R1351:Rif1	UTSW	2	52111555	missense	possibly damaging	0.74
R1517:Rif1	UTSW	2	52110324	unclassified	probably benign
R1527:Rif1	UTSW	2	52110324	unclassified	probably benign
R1560:Rif1	UTSW	2	52111131	missense	probably damaging	1.00
R1563:Rif1	UTSW	2	52073223	missense	probably damaging	0.99
R1571:Rif1	UTSW	2	52110324	unclassified	probably benign
R1625:Rif1	UTSW	2	52103640	missense	probably benign	0.25
R1679:Rif1	UTSW	2	52110324	unclassified	probably benign
R1689:Rif1	UTSW	2	52110324	unclassified	probably benign
R1731:Rif1	UTSW	2	52110324	unclassified	probably benign
R1744:Rif1	UTSW	2	52112392	missense	possibly damaging	0.56
R1746:Rif1	UTSW	2	52110324	unclassified	probably benign
R1748:Rif1	UTSW	2	52110324	unclassified	probably benign
R1831:Rif1	UTSW	2	52078495	nonsense	probably null
R1902:Rif1	UTSW	2	52116673	missense	possibly damaging	0.93
R1964:Rif1	UTSW	2	52098409	missense	probably benign	0.01
R1978:Rif1	UTSW	2	52110324	unclassified	probably benign
R2000:Rif1	UTSW	2	52081298	missense	probably damaging	0.99
R2030:Rif1	UTSW	2	52092346	missense	probably damaging	1.00
R2056:Rif1	UTSW	2	52093576	missense	probably damaging	1.00
R2106:Rif1	UTSW	2	52110324	unclassified	probably benign
R2109:Rif1	UTSW	2	52110324	unclassified	probably benign
R2125:Rif1	UTSW	2	52110324	unclassified	probably benign
R2126:Rif1	UTSW	2	52110324	unclassified	probably benign
R2145:Rif1	UTSW	2	52111400	missense	possibly damaging	0.63
R2152:Rif1	UTSW	2	52110324	unclassified	probably benign
R2153:Rif1	UTSW	2	52110324	unclassified	probably benign
R2213:Rif1	UTSW	2	52110324	unclassified	probably benign
R2327:Rif1	UTSW	2	52110324	unclassified	probably benign
R2512:Rif1	UTSW	2	52110324	unclassified	probably benign
R2513:Rif1	UTSW	2	52110324	unclassified	probably benign
R2516:Rif1	UTSW	2	52110324	unclassified	probably benign
R2520:Rif1	UTSW	2	52110324	unclassified	probably benign
R2905:Rif1	UTSW	2	52098504	missense	probably damaging	0.99
R3005:Rif1	UTSW	2	52082764	missense	probably damaging	1.00
R3155:Rif1	UTSW	2	52110324	unclassified	probably benign
R3156:Rif1	UTSW	2	52110324	unclassified	probably benign
R3429:Rif1	UTSW	2	52110324	unclassified	probably benign
R3707:Rif1	UTSW	2	52093580	missense	probably damaging	1.00
R3907:Rif1	UTSW	2	52112545	missense	probably benign	0.03
R3978:Rif1	UTSW	2	52116747	critical splice donor site	probably null
R4023:Rif1	UTSW	2	52121087	missense	probably benign	0.01
R4052:Rif1	UTSW	2	52098471	nonsense	probably null
R4668:Rif1	UTSW	2	52111952	missense	probably benign	0.01
R4674:Rif1	UTSW	2	52106942	missense	probably null	1.00
R4715:Rif1	UTSW	2	52073139	utr 5 prime	probably benign
R4766:Rif1	UTSW	2	52098934	missense	probably damaging	1.00
R4783:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4785:Rif1	UTSW	2	52112747	missense	probably damaging	0.96
R4869:Rif1	UTSW	2	52093611	intron	probably benign
R4911:Rif1	UTSW	2	52110518	missense	probably damaging	0.98
R4951:Rif1	UTSW	2	52084986	splice site	probably null
R5044:Rif1	UTSW	2	52109928	missense	probably damaging	0.99
R5088:Rif1	UTSW	2	52092295	missense	possibly damaging	0.91
R5151:Rif1	UTSW	2	52120309	missense	probably damaging	1.00
R5187:Rif1	UTSW	2	52081289	missense	probably damaging	1.00
R5222:Rif1	UTSW	2	52077020	missense	probably benign	0.08
R5243:Rif1	UTSW	2	52111824	missense	possibly damaging	0.86
R5436:Rif1	UTSW	2	52120971	intron	probably benign
R5476:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
R5496:Rif1	UTSW	2	52098916	missense	probably damaging	1.00
R5641:Rif1	UTSW	2	52121158	missense	possibly damaging	0.80
R5883:Rif1	UTSW	2	52105639	critical splice donor site	probably null
R5987:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5990:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R5992:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6019:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6020:Rif1	UTSW	2	52095844	missense	probably damaging	1.00
R6255:Rif1	UTSW	2	52085053	missense	probably damaging	1.00
R6342:Rif1	UTSW	2	52119156	missense	probably damaging	0.97
R6364:Rif1	UTSW	2	52107669	missense	probably damaging	0.97
R6747:Rif1	UTSW	2	52078263	splice site	probably null
R6928:Rif1	UTSW	2	52095961	missense	probably damaging	1.00
R6954:Rif1	UTSW	2	52112691	missense	probably benign	0.00
R7003:Rif1	UTSW	2	52076989	missense	probably benign	0.06
R7310:Rif1	UTSW	2	52105619	missense	probably benign	0.12
R7549:Rif1	UTSW	2	52078507	missense	possibly damaging	0.52
R7603:Rif1	UTSW	2	52076175	missense	probably damaging	1.00
R7673:Rif1	UTSW	2	52088654	missense	probably damaging	1.00
R7741:Rif1	UTSW	2	52085141	missense	probably damaging	0.96
R7777:Rif1	UTSW	2	52116356	missense	probably benign	0.00
R7910:Rif1	UTSW	2	52078387	nonsense	probably null
R7962:Rif1	UTSW	2	52074276	missense	probably damaging	1.00
R8264:Rif1	UTSW	2	52090278	missense	noncoding transcript
R8390:Rif1	UTSW	2	52110923	missense	probably damaging	1.00
R8479:Rif1	UTSW	2	52112551	missense	possibly damaging	0.52
R8490:Rif1	UTSW	2	52110999	missense	probably damaging	0.96
R8762:Rif1	UTSW	2	52111730	missense
R8785:Rif1	UTSW	2	52110481	missense	probably benign	0.06
R8890:Rif1	UTSW	2	52098863	missense	probably damaging	0.99
R9081:Rif1	UTSW	2	52110977	missense	probably damaging	0.99
R9225:Rif1	UTSW	2	52111850	missense	probably benign	0.22
R9284:Rif1	UTSW	2	52108552	missense	probably benign	0.00
R9300:Rif1	UTSW	2	52111139	missense	probably damaging	1.00
R9366:Rif1	UTSW	2	52120344	missense
R9477:Rif1	UTSW	2	52111330	missense	probably benign	0.02
R9522:Rif1	UTSW	2	52081299	missense	probably damaging	1.00
R9573:Rif1	UTSW	2	52110454	missense	probably benign	0.29
R9630:Rif1	UTSW	2	52089595	missense	probably damaging	1.00
X0064:Rif1	UTSW	2	52074315	missense	probably benign	0.00
X0064:Rif1	UTSW	2	52094633	missense	probably damaging	0.96
Z1177:Rif1	UTSW	2	52088648	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGGCTCTGTTGCTGAAACCAATCC -3'
(R):5'- TGTTCTGTTCGTGCTACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTACAGAAACTTCGGTGGTC -3'
(R):5'- GCTACAACTGAGGCTGTACTTTC -3'

Posted On

2013-07-30