Mutagenetix > Incidental Mutations

Incidental Mutation 'R7451:4932438A13Rik'

615871

Institutional Source

Beutler Lab

Gene Symbol

4932438A13Rik

Ensembl Gene

ENSMUSG00000037270

Gene Name

RIKEN cDNA 4932438A13 gene

Synonyms

Tweek, FSA

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7451 (G1)

Quality Score

59.0073

Status

Validated

Chromosome

Chromosomal Location

36863104-37053033 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 37022807 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057272] [ENSMUST00000138950] [ENSMUST00000152564]

Predicted Effect

probably benign
Transcript: ENSMUST00000057272

SMART Domains

Protein: ENSMUSP00000060199
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000138152

SMART Domains

Protein: ENSMUSP00000117809
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	81	106	N/A	INTRINSIC
low complexity region	180	201	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000138950

SMART Domains

Protein: ENSMUSP00000118092
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	254	279	N/A	INTRINSIC
low complexity region	353	374	N/A	INTRINSIC
low complexity region	526	540	N/A	INTRINSIC
low complexity region	543	551	N/A	INTRINSIC
low complexity region	619	651	N/A	INTRINSIC
low complexity region	674	687	N/A	INTRINSIC
low complexity region	861	882	N/A	INTRINSIC
FSA_C	888	1492	N/A	SMART
low complexity region	1495	1506	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000141740

SMART Domains

Protein: ENSMUSP00000117814
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
low complexity region	298	323	N/A	INTRINSIC
low complexity region	397	418	N/A	INTRINSIC
low complexity region	500	510	N/A	INTRINSIC
low complexity region	522	529	N/A	INTRINSIC
low complexity region	605	619	N/A	INTRINSIC
low complexity region	622	630	N/A	INTRINSIC
low complexity region	698	730	N/A	INTRINSIC
low complexity region	753	766	N/A	INTRINSIC
low complexity region	940	961	N/A	INTRINSIC
FSA_C	967	1571	N/A	SMART
low complexity region	1574	1585	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000146948

SMART Domains

Protein: ENSMUSP00000121356
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
low complexity region	121	133	N/A	INTRINSIC
low complexity region	167	177	N/A	INTRINSIC
low complexity region	458	483	N/A	INTRINSIC
low complexity region	557	578	N/A	INTRINSIC
low complexity region	730	744	N/A	INTRINSIC
low complexity region	747	755	N/A	INTRINSIC
low complexity region	823	855	N/A	INTRINSIC
low complexity region	878	891	N/A	INTRINSIC
low complexity region	1065	1086	N/A	INTRINSIC
FSA_C	1092	1696	N/A	SMART
low complexity region	1699	1710	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000152564

SMART Domains

Protein: ENSMUSP00000117808
Gene: ENSMUSG00000037270

Domain	Start	End	E-Value	Type
transmembrane domain	25	47	N/A	INTRINSIC
low complexity region	701	716	N/A	INTRINSIC
low complexity region	767	779	N/A	INTRINSIC
low complexity region	1127	1138	N/A	INTRINSIC
low complexity region	1154	1166	N/A	INTRINSIC
low complexity region	1226	1240	N/A	INTRINSIC
low complexity region	1381	1402	N/A	INTRINSIC
low complexity region	1541	1547	N/A	INTRINSIC
low complexity region	1593	1607	N/A	INTRINSIC
low complexity region	1810	1821	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2182	2191	N/A	INTRINSIC
low complexity region	2336	2349	N/A	INTRINSIC
low complexity region	2614	2657	N/A	INTRINSIC
low complexity region	3468	3480	N/A	INTRINSIC
low complexity region	3717	3742	N/A	INTRINSIC
low complexity region	3816	3837	N/A	INTRINSIC
low complexity region	3919	3929	N/A	INTRINSIC
low complexity region	3941	3948	N/A	INTRINSIC
low complexity region	4024	4038	N/A	INTRINSIC
low complexity region	4041	4049	N/A	INTRINSIC
low complexity region	4117	4149	N/A	INTRINSIC
low complexity region	4172	4185	N/A	INTRINSIC
low complexity region	4359	4380	N/A	INTRINSIC
FSA_C	4386	4990	N/A	SMART
low complexity region	4993	5004	N/A	INTRINSIC

Meta Mutation Damage Score

0.9756

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located on the long arm of chromosome 4 in a region that is associated with susceptibility to celiac disease. The encoded protein is similar to a Chinese hamster protein that is associated with spermatocyte and adipocyte differentiation. The C-terminus of the protein is also similar to a Caenorhabditis elegans protein that plays a role in lipid storage. In mammals, this protein is thought to function in the regulation of epithelial growth and differentiation, and in tumor development. [provided by RefSeq, Oct 2009]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006E09Rik	A	T	11: 101,991,457	N147I	possibly damaging	Het
Abcb6	A	G	1: 75,172,153	I794T	probably damaging	Het
Abcc5	T	A	16: 20,375,070	H767L	probably damaging	Het
Adgrb2	A	T	4: 130,014,557	M1031L	probably damaging	Het
Akna	T	A	4: 63,378,667	M891L	probably benign	Het
Aloxe3	C	A	11: 69,142,920	T620K	possibly damaging	Het
Amph	A	G	13: 19,077,368	Y63C	probably damaging	Het
Asprv1	A	G	6: 86,628,948	I259V	probably benign	Het
Atp7b	C	T	8: 22,014,684	W652*	probably null	Het
Atp8a2	C	T	14: 59,791,181	D946N	probably null	Het
BC024063	T	A	10: 82,108,742	N65K	probably benign	Het
Bean1	A	T	8: 104,213,996	M154L	probably benign	Het
Cacna1c	C	T	6: 118,594,020	V2181M	unknown	Het
Cacna1g	A	G	11: 94,429,075	I1425T	probably damaging	Het
Caskin2	A	G	11: 115,812,155		probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cfd	T	A	10: 79,891,528	V43E	probably damaging	Het
Chd9	GCCCC	GCCC	8: 91,033,790		probably null	Het
Chd9	T	A	8: 91,033,818	S2064T	probably benign	Het
Cpsf2	T	G	12: 102,000,792	V646G	possibly damaging	Het
Ctif	T	C	18: 75,519,803	D461G	possibly damaging	Het
Cyp3a41a	T	A	5: 145,699,740	E414D	probably benign	Het
Dagla	A	G	19: 10,253,355	V544A	probably damaging	Het
Dhx57	A	T	17: 80,247,113	V1228E	probably damaging	Het
Eif2b3	T	A	4: 117,052,796	L176*	probably null	Het
Fbxw26	T	A	9: 109,732,623	I168L	probably benign	Het
Flt3	T	A	5: 147,349,667	Y703F	probably damaging	Het
Frmpd1	C	T	4: 45,279,558	P761L	probably benign	Het
Gabrd	A	G	4: 155,388,459	V89A	possibly damaging	Het
Galnt14	A	T	17: 73,574,809	H98Q	probably benign	Het
Gli3	T	C	13: 15,726,291	V1421A	possibly damaging	Het
Gprin2	A	G	14: 34,195,805	S3P	probably damaging	Het
Ifi211	T	G	1: 173,899,492	D362A	probably damaging	Het
Lars	G	T	18: 42,202,550	T1167K	probably benign	Het
Lce1b	T	C	3: 92,655,900	S109G	unknown	Het
Lrp2	T	G	2: 69,513,333	E894A	probably damaging	Het
Mamdc4	A	G	2: 25,564,461	V1081A	possibly damaging	Het
Mcub	T	C	3: 129,917,103	S227G	possibly damaging	Het
Mki67	A	G	7: 135,699,351	I1318T	probably benign	Het
Mybl2	C	T	2: 163,072,706	T248I	possibly damaging	Het
Myo9b	A	T	8: 71,352,188	H1441L	probably benign	Het
Nav2	T	A	7: 49,552,829		probably null	Het
Neb	C	T	2: 52,201,454	V5339I	probably benign	Het
Nktr	T	A	9: 121,729,656	S88T	probably damaging	Het
Nup155	C	T	15: 8,145,607	Q963*	probably null	Het
Oas1c	A	C	5: 120,802,142	L320V	possibly damaging	Het
Olfr108	C	A	17: 37,446,305	S261R	probably damaging	Het
Olfr1254	A	G	2: 89,789,109	M81T	probably benign	Het
Olfr1338	C	T	4: 118,753,687	A286T	probably benign	Het
Olfr149	G	A	9: 39,702,127	T214I	probably damaging	Het
Olfr325	A	G	11: 58,581,690	Y282C	probably damaging	Het
Olfr548-ps1	T	C	7: 102,542,254	I106T	probably benign	Het
Pcdhga7	A	G	18: 37,716,004	S355G	possibly damaging	Het
Pde11a	C	T	2: 76,022,773	V834I	possibly damaging	Het
Pdzrn4	A	T	15: 92,770,067	D700V	possibly damaging	Het
Pif1	C	A	9: 65,588,348	P180Q	probably benign	Het
Pkig	G	T	2: 163,721,163	E5*	probably null	Het
Pla2r1	T	A	2: 60,535,002	M75L	probably damaging	Het
Pllp	T	C	8: 94,676,243	S157G	probably damaging	Het
Ppfia1	A	T	7: 144,508,210	H566Q	probably benign	Het
Ptpn13	A	G	5: 103,527,095	D646G	probably benign	Het
Rab11fip5	T	A	6: 85,341,556	T784S	probably benign	Het
Rad51ap2	T	G	12: 11,457,981	S635A	probably benign	Het
Ranbp17	A	T	11: 33,284,114		probably null	Het
Rce1	C	T	19: 4,625,053	G111D	probably damaging	Het
Rcor3	C	A	1: 192,137,876	G8V	probably damaging	Het
Rhox4d	G	A	X: 37,518,992	G191E	unknown	Het
Rimbp2	C	T	5: 128,788,371	V631I	probably benign	Het
Scai	T	C	2: 39,125,136	T94A	probably damaging	Het
Sfmbt1	G	A	14: 30,816,811	A796T	probably benign	Het
Slc6a11	C	A	6: 114,245,683	Y546*	probably null	Het
Slc7a2	T	C	8: 40,912,649	S506P	probably damaging	Het
Synj2	T	A	17: 6,029,791	N1098K	possibly damaging	Het
Tmem177	G	A	1: 119,910,241	A236V	probably damaging	Het
Togaram1	T	A	12: 64,996,975	D1249E	probably damaging	Het
Trav17	A	T	14: 53,806,639	M1L	probably damaging	Het
Trim25	C	A	11: 89,015,737	A433D	possibly damaging	Het
Trim69	T	C	2: 122,168,027	F160S	probably benign	Het
Trio	A	T	15: 27,747,913	V1407E	probably benign	Het
Trpm7	A	T	2: 126,826,737	M753K	probably damaging	Het
Ttc12	G	T	9: 49,471,879	A75E	probably benign	Het
Uchl4	A	T	9: 64,235,731	I165L	probably benign	Het
Uvrag	A	T	7: 99,140,913	L13Q	unknown	Het
Wwc2	G	A	8: 47,864,575	R656W	not run	Het

Other mutations in 4932438A13Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00428:4932438A13Rik	APN	3	37011727	missense	probably benign	0.00
IGL00434:4932438A13Rik	APN	3	36987299	missense	probably damaging	0.98
IGL00640:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00693:4932438A13Rik	APN	3	37052547	utr 3 prime	probably benign
IGL00721:4932438A13Rik	APN	3	37030751	splice site	probably null
IGL00756:4932438A13Rik	APN	3	36908218	missense	probably damaging	1.00
IGL00896:4932438A13Rik	APN	3	37039462	missense	probably benign
IGL00902:4932438A13Rik	APN	3	37041345	missense	probably damaging	1.00
IGL00980:4932438A13Rik	APN	3	37000041	missense	probably damaging	1.00
IGL01019:4932438A13Rik	APN	3	37006984	critical splice acceptor site	probably null
IGL01025:4932438A13Rik	APN	3	37046280	missense	possibly damaging	0.89
IGL01306:4932438A13Rik	APN	3	37005013	splice site	probably benign
IGL01370:4932438A13Rik	APN	3	36947755	missense	probably benign	0.07
IGL01377:4932438A13Rik	APN	3	36973452	critical splice donor site	probably null
IGL01401:4932438A13Rik	APN	3	36942292	missense	probably benign
IGL01419:4932438A13Rik	APN	3	37048121	missense	probably damaging	1.00
IGL01432:4932438A13Rik	APN	3	37003759	missense	possibly damaging	0.87
IGL01433:4932438A13Rik	APN	3	36887770	missense	probably damaging	1.00
IGL01452:4932438A13Rik	APN	3	36996308	unclassified	probably benign
IGL01520:4932438A13Rik	APN	3	36973260	nonsense	probably null
IGL01524:4932438A13Rik	APN	3	36942382	missense	possibly damaging	0.90
IGL01628:4932438A13Rik	APN	3	37008485	missense	probably damaging	1.00
IGL01638:4932438A13Rik	APN	3	36974311	missense	probably damaging	1.00
IGL01650:4932438A13Rik	APN	3	36992673	splice site	probably benign
IGL01717:4932438A13Rik	APN	3	37034736	missense	probably benign
IGL01767:4932438A13Rik	APN	3	37041363	missense	probably benign	0.29
IGL01813:4932438A13Rik	APN	3	36928520	missense	possibly damaging	0.90
IGL01998:4932438A13Rik	APN	3	36957016	missense	possibly damaging	0.49
IGL02172:4932438A13Rik	APN	3	37004873	missense	probably damaging	0.99
IGL02197:4932438A13Rik	APN	3	36906735	missense	probably damaging	1.00
IGL02248:4932438A13Rik	APN	3	36969290	critical splice donor site	probably null
IGL02273:4932438A13Rik	APN	3	36921437	splice site	probably benign
IGL02403:4932438A13Rik	APN	3	37030664	missense	probably benign
IGL02492:4932438A13Rik	APN	3	37048113	missense	probably benign	0.04
IGL02517:4932438A13Rik	APN	3	36958868	missense	probably damaging	1.00
IGL02519:4932438A13Rik	APN	3	36895315	missense	probably damaging	1.00
IGL02586:4932438A13Rik	APN	3	37044608	nonsense	probably null
IGL02620:4932438A13Rik	APN	3	37035945	missense	possibly damaging	0.95
IGL02621:4932438A13Rik	APN	3	37041484	splice site	probably benign
IGL02670:4932438A13Rik	APN	3	36967305	nonsense	probably null
IGL02806:4932438A13Rik	APN	3	36946494	missense	possibly damaging	0.95
IGL02985:4932438A13Rik	APN	3	36958757	missense	probably damaging	0.99
IGL03004:4932438A13Rik	APN	3	36965677	splice site	probably benign
IGL03037:4932438A13Rik	APN	3	36969207	missense	probably benign	0.23
IGL03037:4932438A13Rik	APN	3	36969208	missense	probably damaging	1.00
IGL03062:4932438A13Rik	APN	3	37038517	splice site	probably benign
IGL03137:4932438A13Rik	APN	3	37034602	missense	probably damaging	0.98
IGL03150:4932438A13Rik	APN	3	36948066	missense	probably damaging	1.00
IGL03204:4932438A13Rik	APN	3	37050934	splice site	probably benign
IGL03207:4932438A13Rik	APN	3	36949996	missense	possibly damaging	0.73
IGL03256:4932438A13Rik	APN	3	36906683	splice site	probably benign
IGL03264:4932438A13Rik	APN	3	37002635	missense	probably damaging	1.00
IGL03265:4932438A13Rik	APN	3	37047991	missense	probably benign	0.00
IGL03303:4932438A13Rik	APN	3	36870077	missense	possibly damaging	0.90
admonished	UTSW	3	36948304	missense	probably damaging	1.00
alerted	UTSW	3	37033265	missense	possibly damaging	0.85
informed	UTSW	3	36965849	missense	probably damaging	1.00
tipped	UTSW	3	36988085	missense	possibly damaging	0.81
warned	UTSW	3	36965621	missense	probably damaging	1.00
FR4340:4932438A13Rik	UTSW	3	37050752	critical splice acceptor site	probably benign
FR4737:4932438A13Rik	UTSW	3	37050754	critical splice acceptor site	probably benign
PIT4515001:4932438A13Rik	UTSW	3	36974236	missense	probably damaging	1.00
R0035:4932438A13Rik	UTSW	3	36987598	nonsense	probably null
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0047:4932438A13Rik	UTSW	3	36908192	missense	possibly damaging	0.83
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0068:4932438A13Rik	UTSW	3	36952221	missense	probably benign	0.28
R0092:4932438A13Rik	UTSW	3	37028159	missense	probably benign	0.41
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0233:4932438A13Rik	UTSW	3	36948563	nonsense	probably null
R0256:4932438A13Rik	UTSW	3	36917773	missense	probably benign	0.01
R0277:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0321:4932438A13Rik	UTSW	3	36906788	splice site	probably null
R0323:4932438A13Rik	UTSW	3	36943182	nonsense	probably null
R0335:4932438A13Rik	UTSW	3	36969152	missense	probably damaging	1.00
R0375:4932438A13Rik	UTSW	3	37046252	missense	probably damaging	0.99
R0437:4932438A13Rik	UTSW	3	36989804	missense	possibly damaging	0.81
R0445:4932438A13Rik	UTSW	3	37000065	missense	probably damaging	0.99
R0496:4932438A13Rik	UTSW	3	36987635	missense	probably damaging	1.00
R0531:4932438A13Rik	UTSW	3	37036825	missense	probably damaging	1.00
R0543:4932438A13Rik	UTSW	3	36996458	missense	probably benign	0.22
R0545:4932438A13Rik	UTSW	3	36987690	splice site	probably benign
R0674:4932438A13Rik	UTSW	3	37044626	missense	possibly damaging	0.86
R0745:4932438A13Rik	UTSW	3	36928463	missense	probably damaging	1.00
R0755:4932438A13Rik	UTSW	3	36946364	missense	probably damaging	1.00
R0785:4932438A13Rik	UTSW	3	36959334	splice site	probably benign
R1056:4932438A13Rik	UTSW	3	36983453	missense	possibly damaging	0.69
R1056:4932438A13Rik	UTSW	3	37044680	missense	probably benign	0.44
R1080:4932438A13Rik	UTSW	3	36988255	missense	probably damaging	1.00
R1103:4932438A13Rik	UTSW	3	36996523	missense	probably benign
R1119:4932438A13Rik	UTSW	3	36987045	missense	probably damaging	1.00
R1170:4932438A13Rik	UTSW	3	37044631	missense	probably damaging	0.98
R1183:4932438A13Rik	UTSW	3	36895303	missense	possibly damaging	0.51
R1186:4932438A13Rik	UTSW	3	36996312	unclassified	probably benign
R1201:4932438A13Rik	UTSW	3	36948375	missense	probably benign
R1219:4932438A13Rik	UTSW	3	36946470	nonsense	probably null
R1270:4932438A13Rik	UTSW	3	36952184	missense	probably damaging	1.00
R1273:4932438A13Rik	UTSW	3	36987210	missense	probably damaging	1.00
R1338:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1364:4932438A13Rik	UTSW	3	36987030	missense	probably damaging	1.00
R1437:4932438A13Rik	UTSW	3	36942429	missense	possibly damaging	0.65
R1447:4932438A13Rik	UTSW	3	36965586	missense	probably damaging	0.98
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1467:4932438A13Rik	UTSW	3	37035945	missense	probably damaging	0.99
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1470:4932438A13Rik	UTSW	3	36998331	missense	probably benign	0.31
R1481:4932438A13Rik	UTSW	3	37008434	missense	probably damaging	0.99
R1528:4932438A13Rik	UTSW	3	37052535	missense	unknown
R1533:4932438A13Rik	UTSW	3	37041375	missense	probably damaging	1.00
R1546:4932438A13Rik	UTSW	3	36870056	missense	possibly damaging	0.64
R1606:4932438A13Rik	UTSW	3	36942399	missense	probably damaging	1.00
R1638:4932438A13Rik	UTSW	3	37035812	nonsense	probably null
R1772:4932438A13Rik	UTSW	3	36959432	missense	probably damaging	1.00
R1896:4932438A13Rik	UTSW	3	36908231	nonsense	probably null
R1919:4932438A13Rik	UTSW	3	37006983	critical splice acceptor site	probably null
R1983:4932438A13Rik	UTSW	3	36887865	missense	probably null	1.00
R1987:4932438A13Rik	UTSW	3	36953985	critical splice donor site	probably null
R1992:4932438A13Rik	UTSW	3	37000032	missense	probably benign	0.32
R1999:4932438A13Rik	UTSW	3	36908211	missense	probably damaging	1.00
R2004:4932438A13Rik	UTSW	3	36895378	missense	possibly damaging	0.77
R2010:4932438A13Rik	UTSW	3	36928551	missense	probably benign	0.09
R2027:4932438A13Rik	UTSW	3	37047961	splice site	probably benign
R2039:4932438A13Rik	UTSW	3	37003878	missense	possibly damaging	0.66
R2054:4932438A13Rik	UTSW	3	36947853	missense	probably benign	0.01
R2089:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36953970	missense	probably damaging	1.00
R2091:4932438A13Rik	UTSW	3	36988256	missense	probably damaging	1.00
R2220:4932438A13Rik	UTSW	3	36875530	critical splice donor site	probably null
R2374:4932438A13Rik	UTSW	3	36885396	missense	probably benign	0.00
R2437:4932438A13Rik	UTSW	3	36958685	splice site	probably null
R2860:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2861:4932438A13Rik	UTSW	3	36965849	missense	probably damaging	1.00
R2909:4932438A13Rik	UTSW	3	36947953	missense	probably damaging	1.00
R2925:4932438A13Rik	UTSW	3	37007122	missense	probably damaging	0.99
R2940:4932438A13Rik	UTSW	3	36958805	missense	probably damaging	1.00
R3015:4932438A13Rik	UTSW	3	36875462	missense	probably damaging	1.00
R3086:4932438A13Rik	UTSW	3	37011703	missense	possibly damaging	0.56
R3159:4932438A13Rik	UTSW	3	36959415	missense	probably benign	0.17
R3440:4932438A13Rik	UTSW	3	37041912	nonsense	probably null
R3703:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3705:4932438A13Rik	UTSW	3	36987581	missense	probably damaging	1.00
R3795:4932438A13Rik	UTSW	3	37030565	missense	probably benign	0.30
R3820:4932438A13Rik	UTSW	3	37040434	missense	probably damaging	1.00
R3862:4932438A13Rik	UTSW	3	36885398	missense	possibly damaging	0.73
R3944:4932438A13Rik	UTSW	3	37030061	missense	possibly damaging	0.90
R4020:4932438A13Rik	UTSW	3	37012575	intron	probably benign
R4091:4932438A13Rik	UTSW	3	37030589	missense	probably benign	0.00
R4159:4932438A13Rik	UTSW	3	36931083	missense	probably benign	0.00
R4231:4932438A13Rik	UTSW	3	36920236	missense	probably benign	0.10
R4368:4932438A13Rik	UTSW	3	36988147	nonsense	probably null
R4413:4932438A13Rik	UTSW	3	36958681	splice site	probably null
R4475:4932438A13Rik	UTSW	3	37040395	missense	probably damaging	1.00
R4488:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4489:4932438A13Rik	UTSW	3	37003933	missense	probably null	0.93
R4516:4932438A13Rik	UTSW	3	36895311	missense	possibly damaging	0.90
R4580:4932438A13Rik	UTSW	3	37030025	missense	probably benign	0.02
R4672:4932438A13Rik	UTSW	3	36889990	makesense	probably null
R4705:4932438A13Rik	UTSW	3	37041889	missense	probably benign	0.03
R4735:4932438A13Rik	UTSW	3	37004967	missense	possibly damaging	0.84
R4741:4932438A13Rik	UTSW	3	36942375	missense	probably damaging	0.99
R4754:4932438A13Rik	UTSW	3	37022466	nonsense	probably null
R4778:4932438A13Rik	UTSW	3	36937065	missense	possibly damaging	0.90
R4833:4932438A13Rik	UTSW	3	36964968	missense	probably damaging	0.96
R4896:4932438A13Rik	UTSW	3	36965937	missense	probably damaging	1.00
R4910:4932438A13Rik	UTSW	3	36998199	missense	probably damaging	1.00
R4922:4932438A13Rik	UTSW	3	36987165	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36917702	missense	probably damaging	1.00
R4941:4932438A13Rik	UTSW	3	36919901	missense	probably benign	0.41
R4980:4932438A13Rik	UTSW	3	36943312	missense	probably damaging	1.00
R5030:4932438A13Rik	UTSW	3	36943399	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37040506	intron	probably benign
R5049:4932438A13Rik	UTSW	3	37041390	missense	probably damaging	1.00
R5089:4932438A13Rik	UTSW	3	36987502	missense	probably benign	0.02
R5092:4932438A13Rik	UTSW	3	37000085	missense	probably benign	0.14
R5122:4932438A13Rik	UTSW	3	37034757	splice site	probably null
R5210:4932438A13Rik	UTSW	3	37033265	missense	possibly damaging	0.85
R5246:4932438A13Rik	UTSW	3	37048050	missense	probably damaging	1.00
R5289:4932438A13Rik	UTSW	3	37000109	missense	probably damaging	0.97
R5348:4932438A13Rik	UTSW	3	37048146	missense	probably damaging	1.00
R5394:4932438A13Rik	UTSW	3	36917668	missense	probably damaging	1.00
R5434:4932438A13Rik	UTSW	3	36875516	missense	probably damaging	1.00
R5667:4932438A13Rik	UTSW	3	36917677	missense	probably benign	0.00
R5686:4932438A13Rik	UTSW	3	36917660	missense	probably benign	0.00
R5701:4932438A13Rik	UTSW	3	36921360	missense	probably benign	0.10
R5778:4932438A13Rik	UTSW	3	36958714	missense	probably damaging	1.00
R5787:4932438A13Rik	UTSW	3	36992733	splice site	probably null
R5800:4932438A13Rik	UTSW	3	37052443	missense	probably damaging	1.00
R5819:4932438A13Rik	UTSW	3	37048600	missense	probably benign	0.12
R5820:4932438A13Rik	UTSW	3	37039526	missense	probably benign	0.00
R5952:4932438A13Rik	UTSW	3	36965621	missense	probably damaging	1.00
R5975:4932438A13Rik	UTSW	3	36969221	missense	possibly damaging	0.64
R5996:4932438A13Rik	UTSW	3	36931116	missense	probably benign	0.07
R6192:4932438A13Rik	UTSW	3	36988169	missense	probably benign	0.00
R6225:4932438A13Rik	UTSW	3	36948304	missense	probably damaging	1.00
R6234:4932438A13Rik	UTSW	3	36983471	missense	probably benign	0.00
R6244:4932438A13Rik	UTSW	3	36956999	missense	probably benign
R6263:4932438A13Rik	UTSW	3	36931111	missense	probably benign	0.06
R6351:4932438A13Rik	UTSW	3	36908228	missense	probably damaging	1.00
R6380:4932438A13Rik	UTSW	3	37033307	missense	probably benign	0.19
R6468:4932438A13Rik	UTSW	3	37008443	missense	probably damaging	1.00
R6759:4932438A13Rik	UTSW	3	36988085	missense	possibly damaging	0.81
R6792:4932438A13Rik	UTSW	3	37011566	critical splice acceptor site	probably null
R6809:4932438A13Rik	UTSW	3	36874282	missense	probably damaging	0.98
R6841:4932438A13Rik	UTSW	3	37021481	missense	probably damaging	1.00
R6959:4932438A13Rik	UTSW	3	36967189	missense	probably damaging	1.00
R7102:4932438A13Rik	UTSW	3	36940798	missense	probably damaging	0.99
R7188:4932438A13Rik	UTSW	3	36950013	missense	probably benign	0.06
R7212:4932438A13Rik	UTSW	3	37048009	missense
R7425:4932438A13Rik	UTSW	3	36948341	missense	probably benign
R7425:4932438A13Rik	UTSW	3	36983394	missense	probably benign	0.02
R7604:4932438A13Rik	UTSW	3	36949843	splice site	probably null
R7622:4932438A13Rik	UTSW	3	36948413	nonsense	probably null
R7671:4932438A13Rik	UTSW	3	36943231	missense	probably damaging	0.99
R7699:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7699:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7700:4932438A13Rik	UTSW	3	36974172	missense	possibly damaging	0.67
R7700:4932438A13Rik	UTSW	3	37026154	missense	probably benign	0.00
R7748:4932438A13Rik	UTSW	3	36959335	critical splice acceptor site	probably null
R7767:4932438A13Rik	UTSW	3	36920287	critical splice donor site	probably null
R7787:4932438A13Rik	UTSW	3	36885408	missense	probably damaging	1.00
R7830:4932438A13Rik	UTSW	3	36964932	frame shift	probably null
R7849:4932438A13Rik	UTSW	3	37026328	missense
R7912:4932438A13Rik	UTSW	3	37007069	missense	probably damaging	0.99
R7914:4932438A13Rik	UTSW	3	36946283	missense	probably benign	0.13
R7945:4932438A13Rik	UTSW	3	36965893	missense	probably benign	0.03
R8039:4932438A13Rik	UTSW	3	36943214	missense	probably benign	0.12
R8101:4932438A13Rik	UTSW	3	37008502	missense	probably damaging	1.00
R8143:4932438A13Rik	UTSW	3	36946508	critical splice donor site	probably null
R8145:4932438A13Rik	UTSW	3	36998267	missense	probably damaging	1.00
R8171:4932438A13Rik	UTSW	3	36975713	missense	probably benign	0.00
R8210:4932438A13Rik	UTSW	3	37012881	missense
R8250:4932438A13Rik	UTSW	3	36917662	missense	probably damaging	0.99
R8369:4932438A13Rik	UTSW	3	37011603	missense
R8478:4932438A13Rik	UTSW	3	37033277	missense	possibly damaging	0.74
RF013:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
RF015:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF021:4932438A13Rik	UTSW	3	37050748	critical splice acceptor site	probably benign
RF023:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF034:4932438A13Rik	UTSW	3	37050760	critical splice acceptor site	probably benign
RF035:4932438A13Rik	UTSW	3	37050758	critical splice acceptor site	probably benign
RF055:4932438A13Rik	UTSW	3	37050757	critical splice acceptor site	probably benign
X0050:4932438A13Rik	UTSW	3	36957128	missense	probably damaging	1.00
Z1088:4932438A13Rik	UTSW	3	36987567	missense	probably damaging	1.00
Z1177:4932438A13Rik	UTSW	3	36919950	missense	probably benign
Z1177:4932438A13Rik	UTSW	3	36983440	missense	possibly damaging	0.88
Z1177:4932438A13Rik	UTSW	3	37036707	missense

Predicted Primers

PCR Primer
(F):5'- ATCTGCACTTCCAGCAAGC -3'
(R):5'- ACTGTGGTGAACTTCCCCAC -3'

Sequencing Primer
(F):5'- ACTTCCAGCAAGCAGGTG -3'
(R):5'- GGTGAACTTCCCCACACTGTG -3'

Posted On

2020-01-02