Incidental Mutation 'R7451:Nav2'
ID615872
Institutional Source Beutler Lab
Gene Symbol Nav2
Ensembl Gene ENSMUSG00000052512
Gene Nameneuron navigator 2
SynonymsRainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.534) question?
Stock #R7451 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location48908716-49610090 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 49552829 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000064395] [ENSMUST00000064395] [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000183659] [ENSMUST00000183659] [ENSMUST00000183659] [ENSMUST00000184109] [ENSMUST00000184945] [ENSMUST00000184945] [ENSMUST00000184945] [ENSMUST00000184945]
Predicted Effect probably null
Transcript: ENSMUST00000064395
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064395
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064395
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000064395
SMART Domains Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183659
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183659
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183659
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183659
SMART Domains Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
CH 23 126 6.19e-16 SMART
low complexity region 141 149 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 276 287 N/A INTRINSIC
low complexity region 351 363 N/A INTRINSIC
coiled coil region 425 455 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
low complexity region 552 564 N/A INTRINSIC
low complexity region 579 601 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
low complexity region 859 883 N/A INTRINSIC
low complexity region 886 906 N/A INTRINSIC
low complexity region 929 943 N/A INTRINSIC
low complexity region 1001 1013 N/A INTRINSIC
low complexity region 1282 1299 N/A INTRINSIC
low complexity region 1307 1324 N/A INTRINSIC
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1393 1405 N/A INTRINSIC
low complexity region 1465 1479 N/A INTRINSIC
low complexity region 1553 1567 N/A INTRINSIC
coiled coil region 1569 1656 N/A INTRINSIC
low complexity region 1728 1739 N/A INTRINSIC
coiled coil region 1780 1848 N/A INTRINSIC
AAA 2032 2186 1.69e-5 SMART
low complexity region 2343 2369 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184109
SMART Domains Protein: ENSMUSP00000138846
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
low complexity region 154 171 N/A INTRINSIC
low complexity region 179 196 N/A INTRINSIC
low complexity region 228 243 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184945
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184945
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184945
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184945
SMART Domains Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512

DomainStartEndE-ValueType
CH 84 187 1.58e-13 SMART
low complexity region 202 210 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
low complexity region 412 424 N/A INTRINSIC
coiled coil region 486 516 N/A INTRINSIC
low complexity region 580 591 N/A INTRINSIC
low complexity region 613 625 N/A INTRINSIC
low complexity region 640 662 N/A INTRINSIC
low complexity region 846 857 N/A INTRINSIC
low complexity region 920 944 N/A INTRINSIC
low complexity region 947 967 N/A INTRINSIC
low complexity region 990 1004 N/A INTRINSIC
low complexity region 1062 1074 N/A INTRINSIC
low complexity region 1343 1360 N/A INTRINSIC
low complexity region 1368 1385 N/A INTRINSIC
low complexity region 1417 1432 N/A INTRINSIC
low complexity region 1454 1466 N/A INTRINSIC
low complexity region 1526 1540 N/A INTRINSIC
low complexity region 1614 1628 N/A INTRINSIC
coiled coil region 1630 1717 N/A INTRINSIC
low complexity region 1789 1800 N/A INTRINSIC
coiled coil region 1841 1909 N/A INTRINSIC
AAA 2093 2247 1.69e-5 SMART
low complexity region 2404 2430 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,991,457 N147I possibly damaging Het
4932438A13Rik G T 3: 37,022,807 probably null Het
Abcb6 A G 1: 75,172,153 I794T probably damaging Het
Abcc5 T A 16: 20,375,070 H767L probably damaging Het
Adgrb2 A T 4: 130,014,557 M1031L probably damaging Het
Akna T A 4: 63,378,667 M891L probably benign Het
Aloxe3 C A 11: 69,142,920 T620K possibly damaging Het
Amph A G 13: 19,077,368 Y63C probably damaging Het
Asprv1 A G 6: 86,628,948 I259V probably benign Het
Atp7b C T 8: 22,014,684 W652* probably null Het
Atp8a2 C T 14: 59,791,181 D946N probably null Het
BC024063 T A 10: 82,108,742 N65K probably benign Het
Bean1 A T 8: 104,213,996 M154L probably benign Het
Cacna1c C T 6: 118,594,020 V2181M unknown Het
Cacna1g A G 11: 94,429,075 I1425T probably damaging Het
Caskin2 A G 11: 115,812,155 probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cfd T A 10: 79,891,528 V43E probably damaging Het
Chd9 GCCCC GCCC 8: 91,033,790 probably null Het
Chd9 T A 8: 91,033,818 S2064T probably benign Het
Cpsf2 T G 12: 102,000,792 V646G possibly damaging Het
Ctif T C 18: 75,519,803 D461G possibly damaging Het
Cyp3a41a T A 5: 145,699,740 E414D probably benign Het
Dagla A G 19: 10,253,355 V544A probably damaging Het
Dhx57 A T 17: 80,247,113 V1228E probably damaging Het
Eif2b3 T A 4: 117,052,796 L176* probably null Het
Fbxw26 T A 9: 109,732,623 I168L probably benign Het
Flt3 T A 5: 147,349,667 Y703F probably damaging Het
Frmpd1 C T 4: 45,279,558 P761L probably benign Het
Gabrd A G 4: 155,388,459 V89A possibly damaging Het
Galnt14 A T 17: 73,574,809 H98Q probably benign Het
Gli3 T C 13: 15,726,291 V1421A possibly damaging Het
Gprin2 A G 14: 34,195,805 S3P probably damaging Het
Ifi211 T G 1: 173,899,492 D362A probably damaging Het
Lars G T 18: 42,202,550 T1167K probably benign Het
Lce1b T C 3: 92,655,900 S109G unknown Het
Lrp2 T G 2: 69,513,333 E894A probably damaging Het
Mamdc4 A G 2: 25,564,461 V1081A possibly damaging Het
Mcub T C 3: 129,917,103 S227G possibly damaging Het
Mki67 A G 7: 135,699,351 I1318T probably benign Het
Mybl2 C T 2: 163,072,706 T248I possibly damaging Het
Myo9b A T 8: 71,352,188 H1441L probably benign Het
Neb C T 2: 52,201,454 V5339I probably benign Het
Nktr T A 9: 121,729,656 S88T probably damaging Het
Nup155 C T 15: 8,145,607 Q963* probably null Het
Oas1c A C 5: 120,802,142 L320V possibly damaging Het
Olfr108 C A 17: 37,446,305 S261R probably damaging Het
Olfr1254 A G 2: 89,789,109 M81T probably benign Het
Olfr1338 C T 4: 118,753,687 A286T probably benign Het
Olfr149 G A 9: 39,702,127 T214I probably damaging Het
Olfr325 A G 11: 58,581,690 Y282C probably damaging Het
Olfr548-ps1 T C 7: 102,542,254 I106T probably benign Het
Pcdhga7 A G 18: 37,716,004 S355G possibly damaging Het
Pde11a C T 2: 76,022,773 V834I possibly damaging Het
Pdzrn4 A T 15: 92,770,067 D700V possibly damaging Het
Pif1 C A 9: 65,588,348 P180Q probably benign Het
Pkig G T 2: 163,721,163 E5* probably null Het
Pla2r1 T A 2: 60,535,002 M75L probably damaging Het
Pllp T C 8: 94,676,243 S157G probably damaging Het
Ppfia1 A T 7: 144,508,210 H566Q probably benign Het
Ptpn13 A G 5: 103,527,095 D646G probably benign Het
Rab11fip5 T A 6: 85,341,556 T784S probably benign Het
Rad51ap2 T G 12: 11,457,981 S635A probably benign Het
Ranbp17 A T 11: 33,284,114 probably null Het
Rce1 C T 19: 4,625,053 G111D probably damaging Het
Rcor3 C A 1: 192,137,876 G8V probably damaging Het
Rhox4d G A X: 37,518,992 G191E unknown Het
Rimbp2 C T 5: 128,788,371 V631I probably benign Het
Scai T C 2: 39,125,136 T94A probably damaging Het
Sfmbt1 G A 14: 30,816,811 A796T probably benign Het
Slc6a11 C A 6: 114,245,683 Y546* probably null Het
Slc7a2 T C 8: 40,912,649 S506P probably damaging Het
Synj2 T A 17: 6,029,791 N1098K possibly damaging Het
Tmem177 G A 1: 119,910,241 A236V probably damaging Het
Togaram1 T A 12: 64,996,975 D1249E probably damaging Het
Trav17 A T 14: 53,806,639 M1L probably damaging Het
Trim25 C A 11: 89,015,737 A433D possibly damaging Het
Trim69 T C 2: 122,168,027 F160S probably benign Het
Trio A T 15: 27,747,913 V1407E probably benign Het
Trpm7 A T 2: 126,826,737 M753K probably damaging Het
Ttc12 G T 9: 49,471,879 A75E probably benign Het
Uchl4 A T 9: 64,235,731 I165L probably benign Het
Uvrag A T 7: 99,140,913 L13Q unknown Het
Wwc2 G A 8: 47,864,575 R656W not run Het
Other mutations in Nav2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01097:Nav2 APN 7 49571194 missense probably damaging 1.00
IGL01150:Nav2 APN 7 49452521 missense probably benign 0.17
IGL01649:Nav2 APN 7 49575729 missense probably damaging 1.00
IGL01662:Nav2 APN 7 49571209 missense probably damaging 1.00
IGL02297:Nav2 APN 7 49594229 missense probably damaging 0.98
IGL02313:Nav2 APN 7 49558773 missense probably damaging 0.99
IGL02441:Nav2 APN 7 49452512 missense probably damaging 1.00
IGL02472:Nav2 APN 7 49546041 missense probably damaging 1.00
IGL02477:Nav2 APN 7 49582875 missense probably damaging 0.99
IGL02725:Nav2 APN 7 49565095 missense probably damaging 1.00
IGL02944:Nav2 APN 7 49420256 missense probably damaging 0.99
IGL02953:Nav2 APN 7 49548423 missense probably damaging 1.00
IGL03105:Nav2 APN 7 49464879 missense probably damaging 1.00
IGL03234:Nav2 APN 7 49462008 missense possibly damaging 0.94
IGL03274:Nav2 APN 7 49362099 missense probably damaging 1.00
IGL03294:Nav2 APN 7 49491457 nonsense probably null
R0006:Nav2 UTSW 7 49453230 missense possibly damaging 0.50
R0070:Nav2 UTSW 7 49570714 missense probably damaging 1.00
R0113:Nav2 UTSW 7 49535953 missense probably damaging 1.00
R0306:Nav2 UTSW 7 49545903 missense probably benign 0.01
R0346:Nav2 UTSW 7 49604585 missense probably benign 0.11
R0539:Nav2 UTSW 7 49461938 missense probably damaging 1.00
R0669:Nav2 UTSW 7 49408683 missense probably damaging 1.00
R0785:Nav2 UTSW 7 49420333 missense probably benign 0.06
R0970:Nav2 UTSW 7 49584153 missense probably damaging 1.00
R1162:Nav2 UTSW 7 49536040 splice site probably benign
R1274:Nav2 UTSW 7 49604430 nonsense probably null
R1463:Nav2 UTSW 7 49535962 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1464:Nav2 UTSW 7 49362204 missense probably damaging 1.00
R1536:Nav2 UTSW 7 49545934 missense probably damaging 1.00
R1612:Nav2 UTSW 7 49571211 missense probably damaging 1.00
R1638:Nav2 UTSW 7 49452465 missense probably benign
R1731:Nav2 UTSW 7 49548174 missense probably damaging 1.00
R1734:Nav2 UTSW 7 49575720 missense probably damaging 1.00
R1865:Nav2 UTSW 7 49548195 missense possibly damaging 0.95
R1945:Nav2 UTSW 7 49464872 missense probably damaging 1.00
R1997:Nav2 UTSW 7 49548471 missense probably benign 0.16
R2061:Nav2 UTSW 7 49598897 splice site probably benign
R2117:Nav2 UTSW 7 49464580 missense probably benign 0.00
R2174:Nav2 UTSW 7 49452663 missense probably damaging 0.99
R2182:Nav2 UTSW 7 49597254 missense probably benign 0.38
R2251:Nav2 UTSW 7 49453277 missense probably damaging 1.00
R2283:Nav2 UTSW 7 49491404 missense probably damaging 1.00
R2343:Nav2 UTSW 7 49598817 missense possibly damaging 0.82
R2472:Nav2 UTSW 7 49408884 missense probably benign
R2568:Nav2 UTSW 7 49597564 missense probably damaging 1.00
R2656:Nav2 UTSW 7 49545942 missense probably damaging 1.00
R2964:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R2966:Nav2 UTSW 7 49557032 missense probably damaging 1.00
R3817:Nav2 UTSW 7 49464562 missense probably benign 0.00
R3834:Nav2 UTSW 7 49545858 missense possibly damaging 0.91
R4207:Nav2 UTSW 7 49572298 splice site probably null
R4207:Nav2 UTSW 7 49597231 missense probably damaging 1.00
R4411:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4413:Nav2 UTSW 7 49398109 missense probably benign 0.37
R4440:Nav2 UTSW 7 49552037 missense possibly damaging 0.86
R4440:Nav2 UTSW 7 49575263 splice site probably benign
R4454:Nav2 UTSW 7 49548544 splice site probably null
R4729:Nav2 UTSW 7 49452819 missense probably benign 0.17
R4801:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4802:Nav2 UTSW 7 49545852 missense possibly damaging 0.94
R4824:Nav2 UTSW 7 49409001 intron probably benign
R4887:Nav2 UTSW 7 49548434 nonsense probably null
R4908:Nav2 UTSW 7 49604510 missense probably damaging 1.00
R4952:Nav2 UTSW 7 49304540 intron probably benign
R4965:Nav2 UTSW 7 49552877 nonsense probably null
R5169:Nav2 UTSW 7 49548483 nonsense probably null
R5224:Nav2 UTSW 7 49551725 missense probably benign 0.00
R5249:Nav2 UTSW 7 49535913 missense probably damaging 1.00
R5285:Nav2 UTSW 7 49548234 missense probably damaging 1.00
R5314:Nav2 UTSW 7 49408692 small deletion probably benign
R5320:Nav2 UTSW 7 49491373 missense probably benign 0.00
R5377:Nav2 UTSW 7 49589160 missense probably benign 0.02
R5471:Nav2 UTSW 7 49548169 missense probably damaging 1.00
R5754:Nav2 UTSW 7 49557046 missense probably damaging 1.00
R5832:Nav2 UTSW 7 49548069 unclassified probably null
R5884:Nav2 UTSW 7 49597169 nonsense probably null
R5921:Nav2 UTSW 7 49304576 intron probably benign
R6180:Nav2 UTSW 7 49458167 missense probably benign 0.39
R6208:Nav2 UTSW 7 49564103 missense probably damaging 0.99
R6373:Nav2 UTSW 7 49453175 missense probably damaging 1.00
R6450:Nav2 UTSW 7 49594366 missense probably damaging 1.00
R6522:Nav2 UTSW 7 49597533 missense probably damaging 1.00
R6626:Nav2 UTSW 7 49594352 missense probably damaging 1.00
R6695:Nav2 UTSW 7 49464904 missense probably benign 0.04
R6705:Nav2 UTSW 7 49551916 missense probably damaging 1.00
R6842:Nav2 UTSW 7 49458169 missense possibly damaging 0.91
R6847:Nav2 UTSW 7 49491456 missense probably benign 0.14
R7287:Nav2 UTSW 7 49420328 missense probably benign 0.01
R7312:Nav2 UTSW 7 49461924 missense possibly damaging 0.55
R7315:Nav2 UTSW 7 49548289 missense possibly damaging 0.61
R7337:Nav2 UTSW 7 49551773 missense possibly damaging 0.56
R7366:Nav2 UTSW 7 49554203 splice site probably null
R7545:Nav2 UTSW 7 49582857 missense probably damaging 1.00
R7706:Nav2 UTSW 7 49594319 missense probably benign 0.35
R7730:Nav2 UTSW 7 49572397 missense probably damaging 1.00
R7812:Nav2 UTSW 7 49597173 missense probably benign 0.13
X0023:Nav2 UTSW 7 49547899 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49452761 missense possibly damaging 0.47
Z1177:Nav2 UTSW 7 49594223 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGAACCTGCAAGAGTCCTC -3'
(R):5'- GCCTGGCTATCAGAGTATACCAG -3'

Sequencing Primer
(F):5'- GAGTCCTCAGAACTCAGTCTG -3'
(R):5'- TGGCTATCAGAGTATACCAGAGTCAC -3'
Posted On2020-01-02