Incidental Mutation 'R7421:Rasa2'
ID615879
Institutional Source Beutler Lab
Gene Symbol Rasa2
Ensembl Gene ENSMUSG00000032413
Gene NameRAS p21 protein activator 2
SynonymsGAP1m, 5430433H21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R7421 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location96539300-96631617 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96611447 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 50 (V50A)
Ref Sequence ENSEMBL: ENSMUSP00000115629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034984] [ENSMUST00000128346]
Predicted Effect silent
Transcript: ENSMUST00000034984
SMART Domains Protein: ENSMUSP00000034984
Gene: ENSMUSG00000032413

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
C2 38 136 3.78e-16 SMART
C2 171 287 8.48e-19 SMART
RasGAP 300 641 7.05e-140 SMART
PH 604 706 1.98e-17 SMART
BTK 706 742 1.39e-18 SMART
low complexity region 824 838 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128346
AA Change: V50A
SMART Domains Protein: ENSMUSP00000115629
Gene: ENSMUSG00000032413
AA Change: V50A

DomainStartEndE-ValueType
C2 3 79 6.86e-5 SMART
C2 114 230 8.48e-19 SMART
RasGAP 243 584 7.05e-140 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aar2 T C 2: 156,555,995 I309T possibly damaging Het
Abca12 A C 1: 71,247,136 L2513* probably null Het
Abca13 G C 11: 9,510,463 V4158L probably benign Het
Acaca A G 11: 84,363,736 T1880A possibly damaging Het
Arhgap5 C T 12: 52,518,000 R585C probably benign Het
Arsk A C 13: 76,062,515 I471S possibly damaging Het
Asb7 T C 7: 66,660,120 D116G probably damaging Het
Atad2 A G 15: 58,134,926 S17P probably benign Het
Atf5 T C 7: 44,815,138 E10G probably damaging Het
B3gntl1 G T 11: 121,624,178 P255T probably benign Het
Cacna1s A G 1: 136,086,802 N649S probably damaging Het
Ccnc A G 4: 21,743,291 Y192C probably damaging Het
Cd28 A G 1: 60,763,300 N126S probably benign Het
Cep57 A G 9: 13,810,673 S360P possibly damaging Het
Ces1e C T 8: 93,215,075 V257I probably benign Het
Chd1 A G 17: 15,749,398 K913R probably benign Het
Cluap1 A T 16: 3,940,793 D373V probably damaging Het
Cnmd T C 14: 79,645,507 I160V probably benign Het
Col6a4 G A 9: 106,020,795 P1686S probably damaging Het
Coro7 G T 16: 4,668,751 A186E probably benign Het
Cuta T C 17: 26,939,457 probably benign Het
Dnah2 G A 11: 69,492,805 H1098Y probably benign Het
Duox1 T A 2: 122,323,230 C345S probably damaging Het
Ephb4 T A 5: 137,354,425 I90K possibly damaging Het
Erich3 T A 3: 154,733,561 M280K probably damaging Het
Fcer2a T A 8: 3,690,335 H4L probably benign Het
Grk1 A T 8: 13,405,316 I67F probably damaging Het
Grm8 A C 6: 27,762,477 S250A possibly damaging Het
H2-Q6 A G 17: 35,425,228 E62G possibly damaging Het
Inppl1 C T 7: 101,832,937 R144H probably damaging Het
Itga3 G T 11: 95,068,855 P33Q probably benign Het
Itgax G A 7: 128,140,432 S672N probably damaging Het
Itpk1 A T 12: 102,574,065 V253E possibly damaging Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Mrps7 T C 11: 115,604,891 V85A probably benign Het
Muc2 T C 7: 141,748,126 L427P Het
Mum1 T A 10: 80,232,753 S244T probably benign Het
Myef2 G T 2: 125,110,617 Q185K probably benign Het
Olfr1249 T A 2: 89,630,571 D109V probably damaging Het
Olfr22-ps1 G T 11: 73,955,509 C273F unknown Het
Pcdh15 G A 10: 74,454,065 M905I possibly damaging Het
Pgm5 C T 19: 24,709,299 V515M probably benign Het
Pik3r1 A G 13: 101,689,136 I381T probably damaging Het
Pla2g4f A G 2: 120,307,256 M341T probably benign Het
Prmt2 A G 10: 76,221,078 F204L probably benign Het
Scn7a A C 2: 66,675,532 I1671S probably benign Het
Sco2 G A 15: 89,371,720 R244C possibly damaging Het
Slfn1 A G 11: 83,121,141 M28V possibly damaging Het
Slfn9 A T 11: 82,981,371 C846* probably null Het
Slfn9 A G 11: 82,987,736 I189T probably damaging Het
Svil T A 18: 5,056,109 S327R probably benign Het
Tcaf3 A T 6: 42,596,842 N145K probably benign Het
Tcrg-V6 G T 13: 19,190,644 G40W possibly damaging Het
Ttc37 A T 13: 76,148,825 K1100N probably benign Het
Tusc5 G A 11: 76,694,225 R147Q unknown Het
Upp2 G T 2: 58,771,574 V130F possibly damaging Het
Vnn3 G A 10: 23,865,768 A324T probably benign Het
Wasf2 A G 4: 133,185,101 E88G unknown Het
Zfp39 A T 11: 58,890,107 C610S probably damaging Het
Other mutations in Rasa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Rasa2 APN 9 96544860 missense probably damaging 1.00
IGL00661:Rasa2 APN 9 96577553 splice site probably benign
IGL00825:Rasa2 APN 9 96570719 missense probably benign 0.37
IGL01645:Rasa2 APN 9 96582781 nonsense probably null
IGL02260:Rasa2 APN 9 96544319 missense probably benign 0.08
IGL02568:Rasa2 APN 9 96580510 missense probably damaging 1.00
IGL02963:Rasa2 APN 9 96570785 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0018:Rasa2 UTSW 9 96571963 missense probably damaging 1.00
R0144:Rasa2 UTSW 9 96592019 missense probably damaging 0.99
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0238:Rasa2 UTSW 9 96568407 missense probably damaging 1.00
R0295:Rasa2 UTSW 9 96545810 splice site probably null
R0332:Rasa2 UTSW 9 96606176 missense probably damaging 1.00
R0348:Rasa2 UTSW 9 96571959 missense probably damaging 1.00
R0931:Rasa2 UTSW 9 96552404 missense possibly damaging 0.88
R1067:Rasa2 UTSW 9 96552323 missense probably damaging 1.00
R1485:Rasa2 UTSW 9 96544348 missense probably benign 0.00
R1562:Rasa2 UTSW 9 96545750 missense possibly damaging 0.89
R1698:Rasa2 UTSW 9 96568375 missense possibly damaging 0.56
R1980:Rasa2 UTSW 9 96570768 missense probably damaging 0.99
R3055:Rasa2 UTSW 9 96611473 missense possibly damaging 0.77
R4175:Rasa2 UTSW 9 96560777 missense probably benign 0.01
R4258:Rasa2 UTSW 9 96557380 intron probably benign
R4432:Rasa2 UTSW 9 96542407 unclassified probably benign
R4636:Rasa2 UTSW 9 96544337 missense probably benign
R4773:Rasa2 UTSW 9 96544417 missense probably benign
R4990:Rasa2 UTSW 9 96591989 missense probably benign 0.24
R5177:Rasa2 UTSW 9 96544791 nonsense probably null
R5462:Rasa2 UTSW 9 96571918 missense probably damaging 1.00
R5737:Rasa2 UTSW 9 96570665 critical splice donor site probably null
R5775:Rasa2 UTSW 9 96577468 splice site probably null
R5866:Rasa2 UTSW 9 96545770 missense probably benign 0.00
R5938:Rasa2 UTSW 9 96611389 missense possibly damaging 0.50
R6076:Rasa2 UTSW 9 96545646 missense probably benign
R6216:Rasa2 UTSW 9 96544304 missense probably damaging 1.00
R6743:Rasa2 UTSW 9 96611440 missense probably damaging 1.00
R6982:Rasa2 UTSW 9 96560750 missense probably damaging 1.00
R7350:Rasa2 UTSW 9 96544355 missense probably benign 0.16
R7405:Rasa2 UTSW 9 96566027 missense probably benign 0.09
R7490:Rasa2 UTSW 9 96566122 missense possibly damaging 0.48
R7515:Rasa2 UTSW 9 96552300 splice site probably null
R7547:Rasa2 UTSW 9 96611421 missense probably damaging 1.00
R7557:Rasa2 UTSW 9 96557425 missense probably damaging 0.98
R7894:Rasa2 UTSW 9 96602727 missense probably benign 0.13
R7977:Rasa2 UTSW 9 96602727 missense probably benign 0.13
RF017:Rasa2 UTSW 9 96631468 small insertion probably benign
RF029:Rasa2 UTSW 9 96631467 small insertion probably benign
RF047:Rasa2 UTSW 9 96631467 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGGTCACTCTTAGAGACATG -3'
(R):5'- GACCTCTCTGAGCACAAGTTG -3'

Sequencing Primer
(F):5'- CAGCCTACTTAGGAGGTGTGAACTTC -3'
(R):5'- GCCTTCTTCCAGACTGAA -3'
Posted On2020-01-02