Incidental Mutation 'R7537:Insm2'
ID615888
Institutional Source Beutler Lab
Gene Symbol Insm2
Ensembl Gene ENSMUSG00000045440
Gene Nameinsulinoma-associated 2
Synonymsmlt 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7537 (G1)
Quality Score54.0072
Status Validated
Chromosome12
Chromosomal Location55599427-55602086 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55599518 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 16 (S16P)
Ref Sequence ENSEMBL: ENSMUSP00000061046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051857] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051857
AA Change: S16P

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061046
Gene: ENSMUSG00000045440
AA Change: S16P

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 61 78 N/A INTRINSIC
low complexity region 97 114 N/A INTRINSIC
low complexity region 119 136 N/A INTRINSIC
ZnF_C2H2 203 223 1.98e2 SMART
ZnF_C2H2 231 253 7.15e-2 SMART
low complexity region 341 349 N/A INTRINSIC
ZnF_C2H2 354 376 1.2e-3 SMART
ZnF_C2H2 398 420 1.02e1 SMART
low complexity region 433 448 N/A INTRINSIC
ZnF_C2H2 452 475 4.11e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000219432
Predicted Effect probably benign
Transcript: ENSMUST00000219451
Predicted Effect probably benign
Transcript: ENSMUST00000220367
Predicted Effect probably benign
Transcript: ENSMUST00000226244
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 97.9%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,173,988 L2229P possibly damaging Het
Acaca T A 11: 84,260,634 M786K probably damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Adap1 T G 5: 139,293,173 E117D possibly damaging Het
Ap5z1 T C 5: 142,477,298 S746P probably benign Het
Appl2 A G 10: 83,617,428 I208T possibly damaging Het
Astn1 A G 1: 158,505,386 E346G possibly damaging Het
Astn1 G A 1: 158,667,638 probably null Het
Atp23 T A 10: 126,868,725 I180L unknown Het
Bean1 CT C 8: 104,182,032 probably null Het
Cdh23 A T 10: 60,384,945 I1340N probably benign Het
Cdh8 G A 8: 99,098,885 Q493* probably null Het
Ces1g T C 8: 93,319,827 I357V probably benign Het
Ddx46 A G 13: 55,650,478 D226G probably damaging Het
Eea1 C T 10: 95,994,905 Q143* probably null Het
Erlin2 G T 8: 27,031,772 probably null Het
Fat3 T A 9: 15,938,319 D3929V probably damaging Het
Flt3 T C 5: 147,334,437 D898G probably damaging Het
Gm16519 A G 17: 70,929,356 N100S probably benign Het
Gnl1 A G 17: 35,988,536 H533R probably damaging Het
Gphn A G 12: 78,504,680 T301A possibly damaging Het
Herc2 C T 7: 56,219,779 R4295* probably null Het
Jak2 C T 19: 29,298,637 T778I probably benign Het
Lrriq3 A G 3: 155,101,097 T128A probably damaging Het
Lst1 A G 17: 35,186,944 probably null Het
Magi1 G T 6: 93,708,110 Y762* probably null Het
Man2b1 T A 8: 85,090,965 C358* probably null Het
Mga T C 2: 119,935,551 V1432A probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Morc2a C T 11: 3,683,566 Q587* probably null Het
Mrc2 T C 11: 105,292,797 I4T probably benign Het
Muc16 C A 9: 18,638,135 V5621F probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myo3b A G 2: 70,217,169 R340G probably benign Het
Nipal3 T C 4: 135,490,937 Y34C probably damaging Het
Nktr T A 9: 121,749,279 D804E unknown Het
Nlrp4b A G 7: 10,714,889 M340V probably benign Het
Olfr1039 A G 2: 86,131,264 V133A probably benign Het
Olfr385 T A 11: 73,589,268 T157S probably benign Het
Olfr680-ps1 A T 7: 105,092,771 M16K probably benign Het
Olfr701 G A 7: 106,818,374 C97Y probably damaging Het
Pard3 T A 8: 127,610,582 N1271K probably damaging Het
Pcdhb11 A T 18: 37,421,619 M1L possibly damaging Het
Pclo T C 5: 14,682,104 V3540A unknown Het
Pemt A G 11: 59,976,844 F154S probably damaging Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Rnpc3 G T 3: 113,613,832 T376K probably benign Het
Rpe65 A G 3: 159,604,609 Y143C probably damaging Het
Sbk2 T C 7: 4,963,149 E12G probably benign Het
Slc2a5 T C 4: 150,129,069 I106T possibly damaging Het
Snx13 A G 12: 35,085,982 D92G probably damaging Het
Sorl1 C T 9: 41,980,688 V1889I probably benign Het
Spag17 A T 3: 99,939,247 N29I possibly damaging Het
Speg T C 1: 75,401,464 V878A probably damaging Het
Timp4 A G 6: 115,250,460 S53P probably damaging Het
Tssk1 G T 16: 17,895,084 E244D probably benign Het
Usp29 A C 7: 6,961,220 T21P possibly damaging Het
Vmn2r85 A T 10: 130,422,866 V440E probably benign Het
Wdr59 T C 8: 111,490,369 D270G Het
Zbbx G A 3: 75,085,519 P223S probably damaging Het
Zfp936 T A 7: 43,189,815 C235* probably null Het
Zranb3 A T 1: 128,032,847 probably null Het
Other mutations in Insm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
hawaii UTSW 12 55599836 nonsense probably null
R0646:Insm2 UTSW 12 55600440 missense probably benign 0.19
R1166:Insm2 UTSW 12 55600496 missense probably benign
R2508:Insm2 UTSW 12 55600311 missense probably benign 0.00
R3978:Insm2 UTSW 12 55600838 missense probably benign 0.00
R4716:Insm2 UTSW 12 55600892 missense possibly damaging 0.93
R4884:Insm2 UTSW 12 55599761 missense probably damaging 1.00
R5154:Insm2 UTSW 12 55600197 missense probably damaging 1.00
R6067:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6078:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6138:Insm2 UTSW 12 55600014 missense probably damaging 1.00
R6424:Insm2 UTSW 12 55600082 missense probably damaging 1.00
R6969:Insm2 UTSW 12 55600178 missense probably damaging 1.00
R7069:Insm2 UTSW 12 55599836 nonsense probably null
R7117:Insm2 UTSW 12 55600572 missense probably damaging 1.00
R7252:Insm2 UTSW 12 55600520 missense probably benign 0.00
R7289:Insm2 UTSW 12 55600544 missense probably damaging 0.99
R7831:Insm2 UTSW 12 55600538 missense probably damaging 1.00
R8224:Insm2 UTSW 12 55599978 missense probably damaging 1.00
U15987:Insm2 UTSW 12 55600014 missense probably damaging 1.00
Z1088:Insm2 UTSW 12 55599797 missense probably damaging 1.00
Z1177:Insm2 UTSW 12 55600356 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGCTCCCACTCCTGATTGG -3'
(R):5'- GGGAAGGACTCCGCAGAGAC -3'

Sequencing Primer
(F):5'- TCCTGATTGGCCGGCACAG -3'
(R):5'- AGGCAGCGCTCCAGGAAC -3'
Posted On2020-01-08