Incidental Mutation 'R7558:Lemd2'
ID615894
Institutional Source Beutler Lab
Gene Symbol Lemd2
Ensembl Gene ENSMUSG00000044857
Gene NameLEM domain containing 2
SynonymsNET25, Lem2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7558 (G1)
Quality Score43.0073
Status Validated
Chromosome17
Chromosomal Location27189601-27204438 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 27204163 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 86 (A86S)
Ref Sequence ENSEMBL: ENSMUSP00000058221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055117]
Predicted Effect probably benign
Transcript: ENSMUST00000055117
AA Change: A86S

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000058221
Gene: ENSMUSG00000044857
AA Change: A86S

DomainStartEndE-ValueType
LEM 1 42 2.19e-16 SMART
low complexity region 65 86 N/A INTRINSIC
low complexity region 91 112 N/A INTRINSIC
low complexity region 172 183 N/A INTRINSIC
transmembrane domain 221 239 N/A INTRINSIC
Pfam:MSC 251 503 7.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a LEM domain-containing transmembrane protein of the inner nuclear membrane. The protein is involved in nuclear structure organization and plays a role in cell signaling and differentiation. Mutations in this gene result in Cataract 46, juvenile-onset. Multiple transcript variants have been found for this gene. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygotes for a gene-trapped allele die by E11.5 exhibiting reduced embryo size and cell density in neural tissue and mesenchyme, underdeveloped cardiac and neural tissue, and hyperactivation of MAPK and AKT signaling. Heterozygotes show a modest delayin cardiotoxin-induced muscle regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik G T 11: 23,516,285 probably null Het
2410089E03Rik C T 15: 8,225,367 R13C unknown Het
Adgrg6 A T 10: 14,431,607 M817K probably damaging Het
Adh6b T A 3: 138,352,536 D53E probably benign Het
Ap3d1 A G 10: 80,722,921 V283A possibly damaging Het
Arhgap21 A G 2: 20,855,610 Y1329H probably damaging Het
B3gnt9 T C 8: 105,254,672 Y28C probably benign Het
Cactin CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG CCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAGTCGGAG 10: 81,321,318 probably benign Het
Chrd T A 16: 20,738,554 V641E probably damaging Het
Clvs2 A T 10: 33,543,464 I198N probably damaging Het
Dbndd2 T C 2: 164,490,216 S120P probably benign Het
Dsg2 G A 18: 20,594,234 V613I probably benign Het
Dsp A G 13: 38,168,766 M207V probably benign Het
Fignl2 T C 15: 101,054,383 E6G probably damaging Het
Fmod A G 1: 134,040,993 Y257C probably benign Het
Foxk2 T C 11: 121,288,058 S239P probably benign Het
Fstl5 C T 3: 76,429,785 T217I possibly damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gm45140 G A 6: 87,821,529 S34F Het
H2-Q6 A G 17: 35,425,619 E128G probably benign Het
Hmmr A G 11: 40,733,329 F11L probably damaging Het
Igfbpl1 G T 4: 45,813,497 N239K probably damaging Het
Itpr2 G T 6: 146,390,865 D443E probably damaging Het
Kcnt2 A T 1: 140,523,190 I736F probably damaging Het
Kctd11 A T 11: 69,879,590 H207Q probably benign Het
Kif16b A T 2: 142,758,826 D462E probably damaging Het
Kif5a G A 10: 127,248,079 T81I probably damaging Het
Lrp1b T C 2: 41,341,936 D1174G Het
Lrrc8b G T 5: 105,481,711 W641L probably damaging Het
Malt1 T C 18: 65,462,834 C438R probably damaging Het
March8 T C 6: 116,403,565 F126L possibly damaging Het
Nalcn C A 14: 123,486,385 probably null Het
Nyap2 A T 1: 81,269,373 T679S probably benign Het
Olfr1469 T A 19: 13,410,991 C141S probably damaging Het
Olfr503 C G 7: 108,544,721 Y65* probably null Het
Otog C A 7: 46,303,160 P419Q probably damaging Het
Pabpc4 T G 4: 123,294,620 S341A possibly damaging Het
Pikfyve T A 1: 65,272,623 H2006Q probably benign Het
Ppp2r5e A T 12: 75,464,992 V319D probably damaging Het
Ptk2b T C 14: 66,154,179 S969G possibly damaging Het
Rasal2 G A 1: 157,175,836 R436C probably damaging Het
Rpap1 A T 2: 119,771,254 F742I probably benign Het
Ryr2 G A 13: 11,799,825 T687M probably damaging Het
Sec16a A T 2: 26,439,734 F7L Het
Slc14a2 A G 18: 78,192,119 I143T probably benign Het
Slc22a26 T A 19: 7,785,286 M430L possibly damaging Het
Smarcc1 C A 9: 110,147,116 T157K probably damaging Het
Tmem87a A G 2: 120,374,510 I375T probably benign Het
Tmprss15 T C 16: 79,003,414 I609V possibly damaging Het
Tnk2 C A 16: 32,680,085 Q739K probably benign Het
Trio T A 15: 27,831,394 I1340F possibly damaging Het
Trpm6 T C 19: 18,778,665 F91L probably damaging Het
Vax1 T C 19: 59,169,984 T16A unknown Het
Vps13d T G 4: 145,154,580 H1481P Het
Zbtb7a A G 10: 81,148,435 *570W probably null Het
Other mutations in Lemd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01791:Lemd2 APN 17 27190728 missense probably damaging 1.00
IGL02161:Lemd2 APN 17 27190651 missense probably damaging 1.00
IGL02903:Lemd2 APN 17 27193210 splice site probably benign
R0078:Lemd2 UTSW 17 27203728 missense probably benign 0.17
R0458:Lemd2 UTSW 17 27190653 missense probably damaging 0.99
R1396:Lemd2 UTSW 17 27190732 missense probably damaging 1.00
R3106:Lemd2 UTSW 17 27201670 missense probably damaging 1.00
R4319:Lemd2 UTSW 17 27201677 missense possibly damaging 0.87
R4930:Lemd2 UTSW 17 27193832 splice site probably null
R5172:Lemd2 UTSW 17 27195382 nonsense probably null
R5239:Lemd2 UTSW 17 27203799 missense possibly damaging 0.53
R6005:Lemd2 UTSW 17 27190785 missense probably damaging 1.00
R6196:Lemd2 UTSW 17 27193002 nonsense probably null
R6621:Lemd2 UTSW 17 27195392 missense probably benign 0.01
R7208:Lemd2 UTSW 17 27196191 missense probably damaging 1.00
R7552:Lemd2 UTSW 17 27193836 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAAGTGAGGGTCTGCAGTC -3'
(R):5'- ACGTCTACCGCAACAAGCTG -3'

Sequencing Primer
(F):5'- GAGGGCTTGCCCATCTTCAC -3'
(R):5'- CAACAAGCTGCGCCGCC -3'
Posted On2020-01-10