Incidental Mutation 'R7394:Cep89'
ID615897
Institutional Source Beutler Lab
Gene Symbol Cep89
Ensembl Gene ENSMUSG00000023072
Gene Namecentrosomal protein 89
SynonymsCcdc123, 2610507L03Rik
MMRRC Submission
Accession Numbers

Genbank: NM_028120; MGI: 1919390

Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7394 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location35397035-35438689 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 35429928 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 630 (R630H)
Ref Sequence ENSEMBL: ENSMUSP00000121393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079414] [ENSMUST00000141704] [ENSMUST00000206230]
Predicted Effect probably benign
Transcript: ENSMUST00000079414
SMART Domains Protein: ENSMUSP00000078383
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
coiled coil region 670 732 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141704
AA Change: R630H

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000121393
Gene: ENSMUSG00000023072
AA Change: R630H

DomainStartEndE-ValueType
low complexity region 27 62 N/A INTRINSIC
low complexity region 181 190 N/A INTRINSIC
coiled coil region 252 291 N/A INTRINSIC
coiled coil region 372 598 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150421
SMART Domains Protein: ENSMUSP00000121422
Gene: ENSMUSG00000023072

DomainStartEndE-ValueType
coiled coil region 1 35 N/A INTRINSIC
coiled coil region 77 139 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206230
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (66/67)
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik A G 10: 100,609,176 I208V probably benign Het
Abcb11 C T 2: 69,299,867 D282N probably damaging Het
Aldh1l2 T A 10: 83,502,457 I646F probably damaging Het
Alms1 C T 6: 85,622,223 P1344S possibly damaging Het
Ank2 T A 3: 126,936,653 I711L possibly damaging Het
Ankrd6 T C 4: 32,821,298 N251D probably damaging Het
Ap3m1 T C 14: 21,038,079 T304A probably benign Het
Arhgef39 T C 4: 43,499,532 T26A possibly damaging Het
C530008M17Rik GCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GCGCGAGGCCGAGAGGCAGG 5: 76,856,954 probably benign Het
Carnmt1 G T 19: 18,670,837 probably benign Het
Ccr4 C T 9: 114,491,926 R357H probably benign Het
Cd4 T A 6: 124,873,041 M104L probably benign Het
Cd74 A T 18: 60,803,893 probably benign Het
Cdcp1 T C 9: 123,173,813 Y731C probably damaging Het
Cdyl2 A G 8: 116,624,051 S114P not run Het
Cenpv T C 11: 62,536,288 D148G probably damaging Het
Cfap57 T A 4: 118,593,137 Y596F probably benign Het
Clec4a2 C A 6: 123,139,120 A122E unknown Het
Col4a2 A G 8: 11,446,184 T1602A probably benign Het
Cyp2j11 A T 4: 96,316,440 Y290N probably benign Het
Dhx38 A T 8: 109,556,523 V554E probably damaging Het
Ebf2 T C 14: 67,237,526 V70A probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fam217a A T 13: 34,910,279 I499K possibly damaging Het
Fras1 C A 5: 96,712,450 Y2118* probably null Het
Gm3248 A T 14: 5,945,781 probably null Het
Gm5460 T G 14: 34,043,922 D165E possibly damaging Het
Grk4 A T 5: 34,751,618 N490Y probably benign Het
Iglc2 T A 16: 19,195,136 K59* probably null Het
Iqsec3 T A 6: 121,386,610 H895L possibly damaging Het
Itgb7 A G 15: 102,219,254 S410P probably damaging Het
Kmt2d C A 15: 98,856,384 V1613F unknown Het
Lama1 T C 17: 67,717,261 L118P Het
Lrrc25 A T 8: 70,618,180 S204C possibly damaging Het
Malrd1 A G 2: 15,695,199 D619G unknown Het
Ms4a6d G A 19: 11,590,073 Q155* probably null Het
Mup17 G A 4: 61,594,398 S86F probably benign Het
Nbeal2 C T 9: 110,630,189 probably null Het
Nfkb1 A C 3: 135,613,697 V291G possibly damaging Het
Nomo1 G T 7: 46,066,479 V757F probably benign Het
Nutm2 T A 13: 50,470,007 S247T probably damaging Het
Olfr1225 C T 2: 89,170,361 V284I probably benign Het
Olfr1291-ps1 G T 2: 111,499,896 A215S probably damaging Het
Olfr521 C A 7: 99,767,346 H61Q probably damaging Het
Olfr826 T A 10: 130,180,254 I209F probably damaging Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Pcdhb14 A G 18: 37,448,908 I356V probably benign Het
Pnkp T A 7: 44,858,678 S142T probably damaging Het
Ppia T C 11: 6,419,218 S99P possibly damaging Het
Prss47 C T 13: 65,044,993 V325I probably benign Het
Ptk7 T C 17: 46,591,757 D34G probably damaging Het
Pwp2 C T 10: 78,182,480 G126R probably damaging Het
Rasa3 G T 8: 13,595,353 D195E probably benign Het
Rnf150 T A 8: 82,990,471 Y202* probably null Het
Sh2d1b2 T C 1: 170,248,147 V50A probably damaging Het
Slc30a4 C T 2: 122,685,304 V390I possibly damaging Het
Slc30a9 G T 5: 67,352,766 probably null Het
Slc8a3 T A 12: 81,214,058 probably null Het
Smpd3 G A 8: 106,265,010 R304W probably damaging Het
Snta1 A G 2: 154,376,860 S490P probably damaging Het
Srcap T G 7: 127,534,828 M887R probably damaging Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sult2a3 T C 7: 14,111,524 T137A probably benign Het
Tspoap1 C T 11: 87,766,119 Q367* probably null Het
Uroc1 C T 6: 90,345,333 R280C probably damaging Het
Ush2a T C 1: 188,911,416 I4325T possibly damaging Het
Vmn1r32 A G 6: 66,553,189 I201T probably benign Het
Zadh2 C T 18: 84,088,190 A9V probably benign Het
Zfp651 T A 9: 121,767,345 M626K probably damaging Het
Other mutations in Cep89
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00784:Cep89 APN 7 35405707 missense possibly damaging 0.92
IGL01546:Cep89 APN 7 35420900 missense probably damaging 1.00
IGL02001:Cep89 APN 7 35403007 splice site probably benign
IGL02141:Cep89 APN 7 35420924 missense probably damaging 1.00
IGL02468:Cep89 APN 7 35403152 missense probably benign 0.35
IGL02507:Cep89 APN 7 35435565 missense probably damaging 1.00
IGL02612:Cep89 APN 7 35424655 critical splice acceptor site probably null
IGL03324:Cep89 APN 7 35424653 intron probably benign
IGL03396:Cep89 APN 7 35429178 missense probably benign 0.05
3-1:Cep89 UTSW 7 35424722 missense probably damaging 0.99
FR4304:Cep89 UTSW 7 35409641 utr 3 prime probably benign
FR4976:Cep89 UTSW 7 35409641 utr 3 prime probably benign
K2124:Cep89 UTSW 7 35420972 splice site probably benign
R0127:Cep89 UTSW 7 35428262 missense possibly damaging 0.92
R0416:Cep89 UTSW 7 35416402 unclassified probably benign
R0609:Cep89 UTSW 7 35435530 missense probably damaging 1.00
R1442:Cep89 UTSW 7 35418211 splice site probably benign
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1468:Cep89 UTSW 7 35420963 splice site probably null
R1661:Cep89 UTSW 7 35417680 missense possibly damaging 0.66
R3981:Cep89 UTSW 7 35438383 missense probably damaging 1.00
R4414:Cep89 UTSW 7 35416397 unclassified probably benign
R4700:Cep89 UTSW 7 35438437 missense probably benign 0.05
R4963:Cep89 UTSW 7 35403152 missense probably benign 0.35
R4968:Cep89 UTSW 7 35409630 missense possibly damaging 0.90
R4972:Cep89 UTSW 7 35432552 missense probably damaging 1.00
R5578:Cep89 UTSW 7 35409642 unclassified probably benign
R5767:Cep89 UTSW 7 35417645 missense probably damaging 1.00
R5809:Cep89 UTSW 7 35417726 missense probably damaging 0.97
R5890:Cep89 UTSW 7 35429162 missense probably damaging 0.99
R6290:Cep89 UTSW 7 35420263 missense probably damaging 1.00
R6361:Cep89 UTSW 7 35398047 missense probably damaging 1.00
R6627:Cep89 UTSW 7 35427747 missense possibly damaging 0.90
R7272:Cep89 UTSW 7 35438463 missense probably benign 0.03
R7340:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7341:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7347:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7348:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7365:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7366:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7399:Cep89 UTSW 7 35438378 missense probably damaging 1.00
R7422:Cep89 UTSW 7 35428247 missense probably damaging 1.00
R7792:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7793:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R7819:Cep89 UTSW 7 35432543 missense probably benign 0.07
R7860:Cep89 UTSW 7 35414145 missense possibly damaging 0.63
R7899:Cep89 UTSW 7 35429928 missense probably damaging 0.97
R8336:Cep89 UTSW 7 35427716 nonsense probably null
R8669:Cep89 UTSW 7 35429177 missense probably benign 0.04
V7732:Cep89 UTSW 7 35403098 missense probably damaging 1.00
Z1177:Cep89 UTSW 7 35397081 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CCTGACAATCACAGGCCATG -3'
(R):5'- AAGGCTTGTAAGAAACATCACCTG -3'

Sequencing Primer
(F):5'- AATCACAGGCCATGCTGGG -3'
(R):5'- CTTGTAAGAAACATCACCTGGAAGTC -3'
Posted On2020-01-13