Incidental Mutation 'R7464:Stx5a'
ID615913
Institutional Source Beutler Lab
Gene Symbol Stx5a
Ensembl Gene ENSMUSG00000010110
Gene Namesyntaxin 5A
SynonymsD19Ertd627e, 0610031F24Rik, syntaxin 5
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7464 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location8741413-8756069 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 8743504 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010254] [ENSMUST00000049424] [ENSMUST00000073430] [ENSMUST00000163172] [ENSMUST00000175872] [ENSMUST00000175901] [ENSMUST00000176013] [ENSMUST00000176314] [ENSMUST00000176381] [ENSMUST00000177322] [ENSMUST00000177373] [ENSMUST00000210512] [ENSMUST00000210592]
Predicted Effect probably benign
Transcript: ENSMUST00000010254
SMART Domains Protein: ENSMUSP00000010254
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin-5_N 52 74 1.5e-15 PFAM
SCOP:d1fioa_ 92 298 7e-36 SMART
Blast:t_SNARE 258 304 9e-22 BLAST
low complexity region 346 376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049424
SMART Domains Protein: ENSMUSP00000043315
Gene: ENSMUSG00000042729

DomainStartEndE-ValueType
WD40 32 71 9.94e-1 SMART
Blast:WD40 76 113 1e-16 BLAST
WD40 120 159 1.85e0 SMART
Blast:WD40 175 211 2e-16 BLAST
Blast:WD40 214 255 2e-14 BLAST
WD40 258 297 2.8e-3 SMART
low complexity region 326 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073430
SMART Domains Protein: ENSMUSP00000073136
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163172
Predicted Effect probably benign
Transcript: ENSMUST00000175872
SMART Domains Protein: ENSMUSP00000135416
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 2.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000175901
SMART Domains Protein: ENSMUSP00000134951
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176013
SMART Domains Protein: ENSMUSP00000135465
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 143 3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176314
SMART Domains Protein: ENSMUSP00000135348
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176381
SMART Domains Protein: ENSMUSP00000134854
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Pfam:Syntaxin 90 194 1e-15 PFAM
t_SNARE 258 325 4.33e-15 SMART
transmembrane domain 334 353 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177322
SMART Domains Protein: ENSMUSP00000135624
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177373
SMART Domains Protein: ENSMUSP00000134794
Gene: ENSMUSG00000010110

DomainStartEndE-ValueType
Pfam:Syntaxin 1 98 5.2e-15 PFAM
t_SNARE 162 229 4.33e-15 SMART
transmembrane domain 238 257 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210512
Predicted Effect probably benign
Transcript: ENSMUST00000210592
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (79/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aass C T 6: 23,077,153 G736R possibly damaging Het
Acta2 G A 19: 34,252,531 T8I probably benign Het
Ankar A T 1: 72,698,894 V43E possibly damaging Het
Apof A G 10: 128,269,636 I220V probably benign Het
Asxl1 G T 2: 153,397,785 A499S probably benign Het
Baz2a T A 10: 128,122,073 D1069E possibly damaging Het
Baz2b T C 2: 59,977,448 T156A possibly damaging Het
Bbc3 A T 7: 16,317,157 R169W unknown Het
C5ar1 T A 7: 16,248,766 I110L probably benign Het
C87414 C T 5: 93,636,240 C455Y probably damaging Het
Cd19 C A 7: 126,411,803 R323L probably damaging Het
Cdc14b A T 13: 64,196,675 C113* probably null Het
Cngb1 C A 8: 95,254,183 W914L possibly damaging Het
Colgalt2 A G 1: 152,504,144 K445E probably damaging Het
Crebrf A G 17: 26,763,487 M608V unknown Het
Csf1 T A 3: 107,748,875 H280L probably benign Het
Cyp2j11 C A 4: 96,345,120 R113L probably damaging Het
D5Ertd579e G A 5: 36,613,785 H1089Y probably damaging Het
Ddx60 C T 8: 61,940,674 T48M possibly damaging Het
Dock10 T C 1: 80,540,315 D1315G probably damaging Het
Dock2 T G 11: 34,695,278 N526H probably damaging Het
Dram2 T C 3: 106,573,683 *268Q probably null Het
Emc8 A G 8: 120,667,918 Y21H possibly damaging Het
Fam162a A G 16: 36,071,493 L4P probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fbxw10 T A 11: 62,853,298 I307N probably benign Het
Fbxw16 A G 9: 109,439,551 V257A possibly damaging Het
Fer1l6 T A 15: 58,573,247 probably null Het
Galnt7 A G 8: 57,584,020 Y112H possibly damaging Het
Gigyf2 T C 1: 87,428,604 I803T unknown Het
Gm10696 A T 3: 94,176,104 N133K probably benign Het
Gm15292 T A 8: 21,249,894 S45T probably damaging Het
Gm28729 A G 9: 96,521,235 I44T possibly damaging Het
Gm5447 A G 13: 30,974,394 I34V not run Het
H2-M9 A T 17: 36,642,411 probably null Het
Helz G A 11: 107,636,278 C864Y probably damaging Het
Il25 A G 14: 54,933,222 Y84C probably null Het
Itga10 T A 3: 96,648,155 C142S probably damaging Het
Kcna10 A T 3: 107,194,079 M9L probably damaging Het
Klhl6 G T 16: 19,957,113 Q232K possibly damaging Het
Mb21d2 T G 16: 28,929,546 I40L possibly damaging Het
Mdm1 T C 10: 118,152,266 S334P probably benign Het
Mllt10 T A 2: 18,170,279 D549E probably benign Het
Mlxipl T C 5: 135,133,628 V648A probably benign Het
Nars2 A G 7: 97,039,930 K353R probably benign Het
Nav1 T A 1: 135,584,909 M138L probably benign Het
Neb T C 2: 52,193,890 T5635A probably benign Het
Nktr A C 9: 121,750,327 I1154L unknown Het
Olfr1284 T A 2: 111,379,198 L66Q probably damaging Het
Olfr47 T G 6: 43,236,294 S229A probably damaging Het
Olfr761 A T 17: 37,952,280 V248D probably damaging Het
Oxld1 T C 11: 120,457,137 D78G probably benign Het
Pde1b T C 15: 103,524,829 I255T probably benign Het
Pkp4 T A 2: 59,308,137 F244I probably benign Het
Polg2 C A 11: 106,773,714 V305L probably benign Het
Ptpn18 G A 1: 34,473,364 D417N possibly damaging Het
Sash1 T C 10: 8,756,745 D242G possibly damaging Het
Six4 T C 12: 73,112,530 T219A possibly damaging Het
Slc28a3 A C 13: 58,563,021 Y562* probably null Het
Soat1 A T 1: 156,439,317 W310R probably damaging Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Spef2 T C 15: 9,740,585 N30D probably benign Het
Srebf2 T A 15: 82,172,874 I270N probably damaging Het
St8sia3 T C 18: 64,271,518 W289R probably damaging Het
Tacc1 T C 8: 25,164,464 D689G probably damaging Het
Tacc3 A G 5: 33,661,284 D21G probably benign Het
Tapt1 G A 5: 44,188,688 R307* probably null Het
Tbc1d9b T A 11: 50,131,485 V16E probably damaging Het
Tchhl1 G A 3: 93,470,664 R225K probably benign Het
Thumpd3 G A 6: 113,055,769 G156D probably benign Het
Tmem178 C T 17: 80,944,902 P72S probably benign Het
Tmem52 C T 4: 155,469,469 P46S probably benign Het
Tmem94 G T 11: 115,786,256 R118L possibly damaging Het
Tulp3 A T 6: 128,326,829 V269D probably benign Het
Ubr1 A G 2: 120,889,774 probably null Het
Upf1 G A 8: 70,333,423 S962L probably benign Het
Vcpip1 C T 1: 9,746,520 R546Q probably damaging Het
Vmn2r49 A C 7: 9,988,893 S151R probably benign Het
Wac T C 18: 7,871,746 probably null Het
Wrn C T 8: 33,335,996 probably null Het
Zfp286 C A 11: 62,780,801 D149Y probably benign Het
Zfp748 A G 13: 67,541,972 C390R probably damaging Het
Zfp873 A G 10: 82,060,376 T314A possibly damaging Het
Zfyve1 C T 12: 83,551,487 D656N probably benign Het
Zmym1 T A 4: 127,058,935 K18* probably null Het
Other mutations in Stx5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03152:Stx5a APN 19 8749774 critical splice donor site probably null
R0541:Stx5a UTSW 19 8749937 missense probably damaging 1.00
R0726:Stx5a UTSW 19 8754911 missense probably damaging 1.00
R1566:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R1990:Stx5a UTSW 19 8748890 critical splice donor site probably null
R2852:Stx5a UTSW 19 8755112 unclassified probably benign
R3022:Stx5a UTSW 19 8755154 unclassified probably benign
R4426:Stx5a UTSW 19 8749740 missense probably benign 0.02
R4684:Stx5a UTSW 19 8743361 missense probably damaging 0.96
R5594:Stx5a UTSW 19 8748465 missense probably damaging 1.00
R5750:Stx5a UTSW 19 8755137 unclassified probably benign
R5929:Stx5a UTSW 19 8742311 missense probably damaging 0.99
R6644:Stx5a UTSW 19 8755248 unclassified probably benign
R6983:Stx5a UTSW 19 8755169 unclassified probably benign
R7242:Stx5a UTSW 19 8755277 missense unknown
R7258:Stx5a UTSW 19 8754907 critical splice acceptor site probably null
R7871:Stx5a UTSW 19 8755118 missense unknown
R7880:Stx5a UTSW 19 8742328 missense probably damaging 1.00
R7980:Stx5a UTSW 19 8742438 missense probably damaging 1.00
R8375:Stx5a UTSW 19 8755098 missense unknown
X0020:Stx5a UTSW 19 8748890 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- TCATCTGTCTCTGCAGTGGC -3'
(R):5'- CCTCTACATAAGCTGAGTCCAAATC -3'

Sequencing Primer
(F):5'- CAAAGCGCAAGTCCCTCTTTGATG -3'
(R):5'- CTAACCTCATTTTAAGCCAAGGC -3'
Posted On2020-01-13