Incidental Mutation 'R7468:Hectd1'
ID615917
Institutional Source Beutler Lab
Gene Symbol Hectd1
Ensembl Gene ENSMUSG00000035247
Gene NameHECT domain E3 ubiquitin protein ligase 1
Synonymsb2b327Clo, opm, A630086P08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_144788; MGI: 2384768

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7468 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location51743722-51829536 bp(-) (GRCm38)
Type of Mutationsynonymous
DNA Base Change (assembly) T to C at 51744805 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042052] [ENSMUST00000179265] [ENSMUST00000218820]
Predicted Effect probably null
Transcript: ENSMUST00000042052
SMART Domains Protein: ENSMUSP00000046766
Gene: ENSMUSG00000035247

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 395 424 1.44e-1 SMART
ANK 426 455 2.81e-4 SMART
ANK 459 488 1.55e2 SMART
low complexity region 490 509 N/A INTRINSIC
low complexity region 630 654 N/A INTRINSIC
low complexity region 707 723 N/A INTRINSIC
low complexity region 821 832 N/A INTRINSIC
Pfam:Sad1_UNC 1107 1240 9.2e-27 PFAM
low complexity region 1259 1271 N/A INTRINSIC
Pfam:MIB_HERC2 1277 1338 7.6e-27 PFAM
low complexity region 1373 1401 N/A INTRINSIC
low complexity region 1441 1458 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1600 1630 N/A INTRINSIC
low complexity region 1633 1651 N/A INTRINSIC
low complexity region 1674 1703 N/A INTRINSIC
low complexity region 1745 1752 N/A INTRINSIC
PDB:2LC3|A 1879 1966 4e-57 PDB
low complexity region 2101 2117 N/A INTRINSIC
HECTc 2143 2610 8.32e-76 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179265
SMART Domains Protein: ENSMUSP00000136449
Gene: ENSMUSG00000035247

DomainStartEndE-ValueType
low complexity region 317 331 N/A INTRINSIC
ANK 396 425 1.44e-1 SMART
ANK 427 456 2.81e-4 SMART
ANK 460 489 1.55e2 SMART
low complexity region 491 510 N/A INTRINSIC
low complexity region 631 655 N/A INTRINSIC
low complexity region 708 724 N/A INTRINSIC
low complexity region 822 833 N/A INTRINSIC
Pfam:Sad1_UNC 1112 1245 1.3e-26 PFAM
low complexity region 1264 1276 N/A INTRINSIC
Pfam:MIB_HERC2 1282 1341 5.3e-26 PFAM
low complexity region 1378 1406 N/A INTRINSIC
low complexity region 1446 1463 N/A INTRINSIC
low complexity region 1489 1500 N/A INTRINSIC
low complexity region 1513 1529 N/A INTRINSIC
low complexity region 1605 1635 N/A INTRINSIC
low complexity region 1638 1656 N/A INTRINSIC
low complexity region 1679 1708 N/A INTRINSIC
low complexity region 1750 1757 N/A INTRINSIC
PDB:2LC3|A 1884 1971 3e-57 PDB
low complexity region 2106 2122 N/A INTRINSIC
HECTc 2148 2618 4.5e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218820
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Mice that are homozygous for either a gene trapped or an ENU-induced allele exhibit exencephaly associated with impaired head mesenchyme development and neural tube closure, and show eye and cranial vault dysplasia. Homozygotes for another ENU-induced allele show congenital cardiovascular defects. [provided by MGI curators]
Allele List at MGI

All alleles(30) : Gene trapped(29) Chemically induced(1)

Other mutations in this stock
Total: 88 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 T G 1: 156,622,534 N90K possibly damaging Het
Acox1 T C 11: 116,178,175 T415A possibly damaging Het
Acy1 T C 9: 106,437,722 M1V probably null Het
Akap13 G A 7: 75,730,465 R462H probably damaging Het
Alpk3 C A 7: 81,100,998 Y1505* probably null Het
Ankrd17 T C 5: 90,243,043 N2256S probably benign Het
Ankrd22 C A 19: 34,149,292 C46F possibly damaging Het
Arhgef5 A T 6: 43,280,671 K1291* probably null Het
Arl9 T A 5: 77,010,429 Y119* probably null Het
Asb14 T C 14: 26,900,848 V89A probably benign Het
Banp T G 8: 121,949,849 probably null Het
BC051142 T A 17: 34,417,565 probably null Het
Btn2a2 T C 13: 23,482,763 N224S probably benign Het
C1ra C T 6: 124,522,444 Q530* probably null Het
C2cd6 A C 1: 59,068,685 S273A probably benign Het
Cd1d2 A T 3: 86,988,276 probably null Het
Cdc42bpb T C 12: 111,339,873 D132G probably damaging Het
Cfap45 C A 1: 172,535,310 Y289* probably null Het
Chrdl2 T C 7: 100,010,125 probably null Het
Cst10 C T 2: 149,405,576 L71F probably benign Het
Dcaf11 T C 14: 55,565,509 F292L possibly damaging Het
Dgcr8 A G 16: 18,259,623 F641S probably damaging Het
Dnm3 G A 1: 162,321,629 probably null Het
Eral1 T C 11: 78,075,393 K320E probably damaging Het
Eva1a A G 6: 82,092,021 T110A possibly damaging Het
Fbxo42 A G 4: 141,199,606 D399G possibly damaging Het
Frs2 T C 10: 117,074,102 T452A possibly damaging Het
Git2 T A 5: 114,733,897 D542V probably damaging Het
Gm11639 G T 11: 104,749,700 S1088I probably benign Het
Grk2 T A 19: 4,306,035 probably benign Het
Gsg1l2 A G 11: 67,785,284 N158S possibly damaging Het
Hc T C 2: 35,028,051 N740S probably benign Het
Hemk1 A G 9: 107,331,089 probably null Het
Hormad2 G T 11: 4,412,245 Y126* probably null Het
Hr A G 14: 70,558,212 E399G possibly damaging Het
Ick A G 9: 78,157,939 K377R probably benign Het
Ilf3 C A 9: 21,403,411 H780N unknown Het
Inpp5e A T 2: 26,408,149 S147T probably benign Het
Jmjd6 T C 11: 116,842,449 D134G probably damaging Het
Kif23 G T 9: 61,937,175 Y120* probably null Het
Klk12 T A 7: 43,773,356 Y236N probably damaging Het
Kmt5b C A 19: 3,802,799 Y186* probably null Het
Krtap9-5 A G 11: 99,949,306 T278A unknown Het
Lca5 T A 9: 83,423,456 D99V probably damaging Het
Leng9 A G 7: 4,148,801 V292A probably benign Het
Lime1 A G 2: 181,383,342 R231G probably benign Het
Lrmp C A 6: 145,173,701 probably null Het
Mctp2 T A 7: 72,211,690 E402D probably damaging Het
Mrpl28 T A 17: 26,124,615 S116R probably damaging Het
Muc15 A T 2: 110,731,517 R99S probably benign Het
Myh2 G A 11: 67,192,542 A1444T probably benign Het
Mynn T A 3: 30,603,676 Y48N probably damaging Het
Myo1b A T 1: 51,797,480 V274E possibly damaging Het
Nemp1 T A 10: 127,693,054 M209K possibly damaging Het
Nlrc4 G T 17: 74,445,512 D625E probably benign Het
Olfr1192-ps1 T C 2: 88,652,278 L42P probably damaging Het
Olfr122 C T 17: 37,772,019 A122V probably damaging Het
Olfr96 T C 17: 37,225,385 F87L probably benign Het
Otog T C 7: 46,264,119 V792A probably benign Het
Paqr8 T C 1: 20,935,218 Y199H probably damaging Het
Popdc3 A G 10: 45,315,021 D76G probably damaging Het
Ppme1 T C 7: 100,341,862 N210D probably benign Het
Prdm15 A C 16: 97,835,642 Y158* probably null Het
Prrg2 A T 7: 45,060,263 L70Q probably benign Het
Psmg4 C T 13: 34,177,983 R85W probably damaging Het
Rab11fip4 A T 11: 79,689,652 T437S probably benign Het
Rap2a T A 14: 120,478,926 M67K probably damaging Het
Rnf123 A T 9: 108,069,009 H322Q probably benign Het
Rxfp2 A T 5: 150,067,336 T521S possibly damaging Het
Scrn2 T G 11: 97,033,166 V292G possibly damaging Het
Serpina3n C A 12: 104,411,397 P303H probably benign Het
Spop C T 11: 95,485,901 T260M probably damaging Het
Surf2 G A 2: 26,919,342 G224D probably benign Het
Synm T G 7: 67,733,223 N669T unknown Het
Tmprss13 T C 9: 45,328,423 S10P unknown Het
Trav9d-1 T A 14: 52,792,513 S25T probably benign Het
Trpc3 A T 3: 36,624,416 I840K probably damaging Het
Tssc4 C A 7: 143,069,262 probably benign Het
Ttc39d G T 17: 80,216,150 R79S possibly damaging Het
Txlnb T A 10: 17,799,334 S78R probably damaging Het
Vmn1r142 T A 7: 22,163,359 Q226L possibly damaging Het
Vmn1r230 T C 17: 20,846,884 S112P probably damaging Het
Wrnip1 T C 13: 32,816,377 F456L possibly damaging Het
Zc3h8 G T 2: 128,933,295 H148Q probably benign Het
Zcchc3 A G 2: 152,414,695 V28A probably benign Het
Zdbf2 T A 1: 63,307,510 C1683S probably benign Het
Zfp874a T C 13: 67,425,604 probably null Het
Zmym4 A G 4: 126,882,236 S1260P probably benign Het
Other mutations in Hectd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Hectd1 APN 12 51769108 missense possibly damaging 0.94
IGL00402:Hectd1 APN 12 51759432 missense probably benign
IGL00419:Hectd1 APN 12 51764035 missense probably damaging 0.99
IGL00518:Hectd1 APN 12 51776489 splice site probably benign
IGL00565:Hectd1 APN 12 51790398 missense probably damaging 0.97
IGL00574:Hectd1 APN 12 51774004 missense probably benign 0.17
IGL00576:Hectd1 APN 12 51759309 missense probably damaging 0.99
IGL00788:Hectd1 APN 12 51748788 missense probably damaging 0.99
IGL00978:Hectd1 APN 12 51791390 missense possibly damaging 0.95
IGL01328:Hectd1 APN 12 51761121 missense probably damaging 1.00
IGL01337:Hectd1 APN 12 51802274 missense possibly damaging 0.95
IGL01634:Hectd1 APN 12 51803779 missense probably damaging 0.98
IGL01731:Hectd1 APN 12 51802810 missense possibly damaging 0.59
IGL01920:Hectd1 APN 12 51782554 missense probably damaging 0.99
IGL01951:Hectd1 APN 12 51794497 nonsense probably null
IGL01994:Hectd1 APN 12 51797942 missense probably damaging 0.99
IGL02140:Hectd1 APN 12 51774137 missense probably damaging 0.99
IGL02150:Hectd1 APN 12 51769191 missense probably damaging 0.97
IGL02156:Hectd1 APN 12 51754133 splice site probably benign
IGL02177:Hectd1 APN 12 51772320 missense probably damaging 0.99
IGL02502:Hectd1 APN 12 51797852 missense possibly damaging 0.77
IGL02505:Hectd1 APN 12 51800713 critical splice donor site probably null
IGL02519:Hectd1 APN 12 51769111 missense probably damaging 0.99
IGL02624:Hectd1 APN 12 51762450 missense possibly damaging 0.61
IGL02833:Hectd1 APN 12 51764081 missense probably damaging 0.96
IGL02851:Hectd1 APN 12 51767640 missense possibly damaging 0.94
IGL02866:Hectd1 APN 12 51790613 missense probably damaging 1.00
IGL02981:Hectd1 APN 12 51768887 missense possibly damaging 0.70
IGL02987:Hectd1 APN 12 51744767 missense probably damaging 1.00
IGL02999:Hectd1 APN 12 51827422 missense possibly damaging 0.77
IGL03071:Hectd1 APN 12 51769174 missense probably benign 0.00
IGL03078:Hectd1 APN 12 51802236 missense probably damaging 0.98
IGL03299:Hectd1 APN 12 51800888 splice site probably benign
3-1:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R0039:Hectd1 UTSW 12 51753825 missense possibly damaging 0.83
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0238:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0239:Hectd1 UTSW 12 51769318 missense possibly damaging 0.72
R0268:Hectd1 UTSW 12 51769107 missense probably damaging 0.99
R0268:Hectd1 UTSW 12 51769108 missense possibly damaging 0.94
R0409:Hectd1 UTSW 12 51782556 missense possibly damaging 0.59
R1019:Hectd1 UTSW 12 51748657 missense probably damaging 0.99
R1072:Hectd1 UTSW 12 51761072 missense probably benign 0.11
R1087:Hectd1 UTSW 12 51776572 missense probably damaging 0.99
R1165:Hectd1 UTSW 12 51764164 splice site probably benign
R1350:Hectd1 UTSW 12 51762434 missense probably benign
R1553:Hectd1 UTSW 12 51773878 missense probably damaging 0.98
R1666:Hectd1 UTSW 12 51753824 missense possibly damaging 0.91
R1676:Hectd1 UTSW 12 51744788 missense probably damaging 1.00
R1694:Hectd1 UTSW 12 51744592 missense probably damaging 1.00
R1778:Hectd1 UTSW 12 51753807 missense probably damaging 0.99
R1856:Hectd1 UTSW 12 51744794 missense probably damaging 1.00
R1859:Hectd1 UTSW 12 51806567 missense probably damaging 1.00
R1884:Hectd1 UTSW 12 51800955 missense probably benign 0.00
R1982:Hectd1 UTSW 12 51785841 missense probably damaging 0.97
R2034:Hectd1 UTSW 12 51757116 splice site probably null
R2061:Hectd1 UTSW 12 51794444 missense probably damaging 0.99
R2078:Hectd1 UTSW 12 51748542 missense probably damaging 0.99
R2176:Hectd1 UTSW 12 51745494 missense probably damaging 1.00
R2210:Hectd1 UTSW 12 51806462 missense probably damaging 0.99
R2248:Hectd1 UTSW 12 51806471 missense probably damaging 0.99
R2282:Hectd1 UTSW 12 51769008 missense possibly damaging 0.95
R2402:Hectd1 UTSW 12 51745534 missense probably benign 0.01
R3876:Hectd1 UTSW 12 51768730 missense probably damaging 0.98
R4027:Hectd1 UTSW 12 51802436 critical splice acceptor site probably null
R4085:Hectd1 UTSW 12 51774750 missense possibly damaging 0.93
R4115:Hectd1 UTSW 12 51768723 nonsense probably null
R4116:Hectd1 UTSW 12 51768723 nonsense probably null
R4169:Hectd1 UTSW 12 51790225 missense probably damaging 0.97
R4434:Hectd1 UTSW 12 51752052 missense probably damaging 1.00
R4507:Hectd1 UTSW 12 51790493 missense probably damaging 0.97
R4578:Hectd1 UTSW 12 51751932 missense probably damaging 1.00
R4579:Hectd1 UTSW 12 51744573 missense probably damaging 0.97
R4709:Hectd1 UTSW 12 51787912 missense possibly damaging 0.94
R4812:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R4883:Hectd1 UTSW 12 51784247 nonsense probably null
R4885:Hectd1 UTSW 12 51800722 missense probably damaging 0.97
R4975:Hectd1 UTSW 12 51762497 missense probably benign 0.02
R4983:Hectd1 UTSW 12 51784262 missense probably benign 0.01
R5007:Hectd1 UTSW 12 51802660 missense possibly damaging 0.95
R5046:Hectd1 UTSW 12 51750388 missense probably damaging 1.00
R5062:Hectd1 UTSW 12 51744879 missense probably damaging 0.98
R5164:Hectd1 UTSW 12 51827489 start codon destroyed probably null 0.60
R5213:Hectd1 UTSW 12 51802533 critical splice donor site probably null
R5535:Hectd1 UTSW 12 51802326 missense probably damaging 0.98
R5776:Hectd1 UTSW 12 51764114 missense possibly damaging 0.91
R5846:Hectd1 UTSW 12 51773835 missense probably damaging 0.99
R5907:Hectd1 UTSW 12 51798754 missense probably damaging 0.98
R5911:Hectd1 UTSW 12 51802252 missense probably damaging 0.99
R5919:Hectd1 UTSW 12 51769072 missense probably damaging 0.98
R6051:Hectd1 UTSW 12 51754104 missense probably benign
R6141:Hectd1 UTSW 12 51746092 critical splice donor site probably null
R6172:Hectd1 UTSW 12 51769282 missense probably damaging 1.00
R6194:Hectd1 UTSW 12 51748445 missense probably damaging 0.99
R6356:Hectd1 UTSW 12 51744619 missense probably damaging 1.00
R6795:Hectd1 UTSW 12 51794487 missense possibly damaging 0.94
R6909:Hectd1 UTSW 12 51764162 splice site probably null
R6971:Hectd1 UTSW 12 51748743 nonsense probably null
R7079:Hectd1 UTSW 12 51787855 missense possibly damaging 0.96
R7104:Hectd1 UTSW 12 51827351 critical splice donor site probably null
R7171:Hectd1 UTSW 12 51759297 missense probably damaging 0.99
R7296:Hectd1 UTSW 12 51785852 missense possibly damaging 0.73
R7346:Hectd1 UTSW 12 51750321 missense probably benign
R7355:Hectd1 UTSW 12 51791298 missense possibly damaging 0.72
R7531:Hectd1 UTSW 12 51806367 missense probably benign 0.33
R7532:Hectd1 UTSW 12 51790450 missense probably damaging 0.98
R7755:Hectd1 UTSW 12 51802220 missense possibly damaging 0.86
R7807:Hectd1 UTSW 12 51745388 missense probably damaging 1.00
R7842:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R7925:Hectd1 UTSW 12 51772560 missense probably damaging 0.99
R8059:Hectd1 UTSW 12 51790378 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TAGCTCGCATCAGTAGCATC -3'
(R):5'- GGCACAATTGTAGAAGTCCTCAG -3'

Sequencing Primer
(F):5'- TCAGTAGCATCAACCTACAGTAAG -3'
(R):5'- ACAATTGTAGAAGTCCTCAGTCCTC -3'
Posted On2020-01-13