Incidental Mutation 'R7581:Olfr420'
ID 615927
Institutional Source Beutler Lab
Gene Symbol Olfr420
Ensembl Gene ENSMUSG00000055033
Gene Name olfactory receptor 420
Synonyms GA_x6K02T2P20D-20995211-20994246, MOR105-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 174155633-174162195 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to A at 174158771 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000069662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068403] [ENSMUST00000213748]
AlphaFold E9Q4G0
Predicted Effect probably null
Transcript: ENSMUST00000068403
SMART Domains Protein: ENSMUSP00000069662
Gene: ENSMUSG00000055033

DomainStartEndE-ValueType
Pfam:7tm_4 31 310 9.9e-60 PFAM
Pfam:7tm_1 41 292 4.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213748
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Xpc A T 6: 91,498,017 probably benign Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Olfr420
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Olfr420 APN 1 174158857 missense probably damaging 1.00
IGL02479:Olfr420 APN 1 174158954 nonsense probably null
IGL03190:Olfr420 APN 1 174159544 missense probably damaging 0.99
IGL03270:Olfr420 APN 1 174159553 missense probably benign 0.04
R0645:Olfr420 UTSW 1 174159354 missense probably benign 0.00
R0834:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R1432:Olfr420 UTSW 1 174158917 missense possibly damaging 0.67
R1508:Olfr420 UTSW 1 174159364 missense possibly damaging 0.55
R2351:Olfr420 UTSW 1 174158920 missense probably damaging 0.99
R3440:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R3441:Olfr420 UTSW 1 174159180 missense probably benign 0.14
R4571:Olfr420 UTSW 1 174158928 missense possibly damaging 0.77
R5072:Olfr420 UTSW 1 174158961 missense probably damaging 1.00
R6060:Olfr420 UTSW 1 174159341 nonsense probably null
R6166:Olfr420 UTSW 1 174159093 missense probably benign 0.43
R6228:Olfr420 UTSW 1 174152146 missense probably benign 0.00
R6272:Olfr420 UTSW 1 174159175 missense probably benign 0.02
R6298:Olfr420 UTSW 1 174152182 missense probably benign 0.02
R6400:Olfr420 UTSW 1 174159264 missense probably damaging 0.99
R7677:Olfr420 UTSW 1 174159048 missense probably damaging 1.00
R7823:Olfr420 UTSW 1 174159688 missense probably benign 0.12
R7829:Olfr420 UTSW 1 174158859 missense probably benign 0.00
R8077:Olfr420 UTSW 1 174151845 unclassified probably benign
R8519:Olfr420 UTSW 1 174159048 missense probably damaging 0.99
R9106:Olfr420 UTSW 1 174158803 missense probably benign 0.00
R9205:Olfr420 UTSW 1 174158890 missense probably benign 0.33
R9507:Olfr420 UTSW 1 174158986 missense possibly damaging 0.94
Z1187:Olfr420 UTSW 1 174159341 nonsense probably null
Z1192:Olfr420 UTSW 1 174159341 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCATTGTGGAGTACATATGATG -3'
(R):5'- TGGTGTACCATATCTCCAGGAAG -3'

Sequencing Primer
(F):5'- TCAAAGCCTGGCTTTTGG -3'
(R):5'- CACTGATGAAGAAGTACATGGGTGTG -3'
Posted On 2020-01-17