Mutagenetix > Incidental Mutations

Incidental Mutation 'R7581:Xpc'

615930

Institutional Source

Beutler Lab

Gene Symbol

Xpc

Ensembl Gene

ENSMUSG00000030094

Gene Name

xeroderma pigmentosum, complementation group C

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.471) question?

Stock #

R7581 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

91489305-91515888 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to T at 91498017 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000032182 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032182]

Predicted Effect

probably benign
Transcript: ENSMUST00000032182

SMART Domains

Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

Domain	Start	End	E-Value	Type
low complexity region	69	82	N/A	INTRINSIC
low complexity region	106	115	N/A	INTRINSIC
low complexity region	118	142	N/A	INTRINSIC
low complexity region	299	315	N/A	INTRINSIC
low complexity region	335	352	N/A	INTRINSIC
low complexity region	371	387	N/A	INTRINSIC
low complexity region	425	439	N/A	INTRINSIC
Pfam:Rad4	485	619	6.4e-26	PFAM
BHD_1	623	675	4.09e-25	SMART
BHD_2	677	737	4.96e-24	SMART
BHD_3	744	818	4.83e-45	SMART
low complexity region	826	835	N/A	INTRINSIC

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.2%

Validation Efficiency

98% (47/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5430403G16Rik	G	A	5: 109,690,788		probably benign	Het
Adamts9	A	C	6: 92,937,338	D196E	probably benign	Het
Adnp	A	T	2: 168,183,466	D636E	probably damaging	Het
Afdn	T	C	17: 13,849,238	V723A	probably damaging	Het
Arid1a	A	T	4: 133,680,351	F1897I	unknown	Het
Atp6v0b	T	C	4: 117,885,286	M137V	probably benign	Het
Bicd1	T	A	6: 149,519,004	I784N	probably damaging	Het
Cckbr	A	G	7: 105,433,786	T119A	probably benign	Het
Creb5	T	C	6: 53,681,237	L184P	probably damaging	Het
Cyp2a22	T	G	7: 26,938,148	K141Q	possibly damaging	Het
D16Ertd472e	T	C	16: 78,546,557	T219A	possibly damaging	Het
Ep400	A	T	5: 110,756,025	L236Q	unknown	Het
Exph5	A	G	9: 53,372,557	S313G	possibly damaging	Het
Gm10024	T	C	10: 77,711,563	V36A	unknown	Het
Gm5493	A	G	17: 22,747,274	E44G	probably damaging	Het
Gtdc1	A	T	2: 44,790,005		probably null	Het
Invs	T	C	4: 48,421,909	V847A	probably benign	Het
Kif18b	C	A	11: 102,914,722	Q236H	probably damaging	Het
Kntc1	A	G	5: 123,816,755	T2079A	probably benign	Het
Large2	A	G	2: 92,370,193	S89P	probably damaging	Het
Maml3	A	C	3: 51,856,768	D258E	probably benign	Het
Mdga2	A	T	12: 66,506,255	M868K	probably damaging	Het
Mtss1l	A	G	8: 110,726,213	E30G	possibly damaging	Het
Muc16	T	C	9: 18,645,614	I3128V	unknown	Het
Mug2	C	T	6: 122,063,711	T740I	probably damaging	Het
Noc2l	T	C	4: 156,245,449	V612A	probably benign	Het
Olfr420	G	A	1: 174,158,771		probably null	Het
Olfr979	A	T	9: 40,000,422	D268E	probably damaging	Het
Padi6	T	C	4: 140,728,929	T585A	probably benign	Het
Pcdhga1	A	T	18: 37,662,177	N78I	probably damaging	Het
Pdgfd	A	G	9: 6,293,894	Y156C	probably damaging	Het
Peg10	GCACATCAGGATCC	GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC	6: 4,756,452		probably benign	Het
Pi4ka	C	T	16: 17,301,060	V1307I		Het
Pip5k1c	A	G	10: 81,308,960	N212D	probably damaging	Het
Plekha1	A	G	7: 130,910,865	T264A	probably benign	Het
Polr2b	A	G	5: 77,326,704	R463G	probably damaging	Het
Psd2	T	G	18: 35,979,997	D248E	probably benign	Het
Rag1	G	T	2: 101,643,304	Q498K	possibly damaging	Het
Ryr3	A	G	2: 112,753,027	I2853T	probably damaging	Het
Selenow	G	T	7: 15,922,382		probably null	Het
Sned1	C	T	1: 93,256,545	S165F	probably benign	Het
Spata31d1a	A	G	13: 59,704,139		probably null	Het
Taar4	C	A	10: 23,961,154	H221N	probably damaging	Het
Tgm6	A	T	2: 130,141,285	R265W	probably damaging	Het
Trpm1	A	T	7: 64,204,555	Q275L	probably benign	Het
Ulk3	T	C	9: 57,592,042	L173P	probably damaging	Het
Urah	A	T	7: 140,835,627	T3S	probably benign	Het
Vmn1r149	A	T	7: 22,437,904	V109D	probably damaging	Het
Zglp1	T	A	9: 21,062,708	K227N	probably damaging	Het

Other mutations in Xpc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Xpc	APN	6	91492264	unclassified	probably benign
IGL01108:Xpc	APN	6	91493005	missense	probably damaging	1.00
IGL01310:Xpc	APN	6	91490107	missense	probably benign	0.02
IGL01323:Xpc	APN	6	91492353	missense	probably damaging	1.00
IGL01350:Xpc	APN	6	91500011	missense	probably benign	0.01
IGL01656:Xpc	APN	6	91505467	missense	probably damaging	0.98
IGL01922:Xpc	APN	6	91505425	missense	probably damaging	1.00
IGL02412:Xpc	APN	6	91499785	missense	probably benign	0.01
IGL02448:Xpc	APN	6	91515744	missense	probably benign	0.00
IGL02571:Xpc	APN	6	91504071	missense	probably benign	0.00
IGL02937:Xpc	APN	6	91500137	missense	probably damaging	1.00
IGL02951:Xpc	APN	6	91506849	missense	probably damaging	1.00
IGL03033:Xpc	APN	6	91491315	splice site	probably null
IGL03248:Xpc	APN	6	91504583	missense	probably damaging	0.99
IGL03046:Xpc	UTSW	6	91510481	missense	probably damaging	1.00
R0031:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0173:Xpc	UTSW	6	91504735	unclassified	probably benign
R0285:Xpc	UTSW	6	91498064	missense	probably damaging	0.99
R0454:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0535:Xpc	UTSW	6	91504578	missense	possibly damaging	0.92
R0554:Xpc	UTSW	6	91491226	missense	probably benign	0.01
R0759:Xpc	UTSW	6	91498142	missense	probably damaging	0.99
R1426:Xpc	UTSW	6	91493238	missense	probably damaging	1.00
R1478:Xpc	UTSW	6	91508528	missense	possibly damaging	0.94
R1676:Xpc	UTSW	6	91492947	missense	possibly damaging	0.56
R1969:Xpc	UTSW	6	91501025	splice site	probably null
R2138:Xpc	UTSW	6	91498122	nonsense	probably null
R2237:Xpc	UTSW	6	91498108	missense	probably damaging	1.00
R4580:Xpc	UTSW	6	91500011	missense	probably benign	0.01
R5318:Xpc	UTSW	6	91493010	missense	probably damaging	1.00
R5567:Xpc	UTSW	6	91498135	missense	probably damaging	1.00
R5681:Xpc	UTSW	6	91504120	missense	probably damaging	1.00
R6022:Xpc	UTSW	6	91499636	missense	probably damaging	0.96
R6791:Xpc	UTSW	6	91506857	missense	probably benign	0.01
R6794:Xpc	UTSW	6	91506857	missense	probably benign	0.01
R6983:Xpc	UTSW	6	91504023	missense	probably damaging	0.99
R7214:Xpc	UTSW	6	91492338	missense	probably damaging	1.00
R7442:Xpc	UTSW	6	91504649	missense	probably damaging	1.00
R7524:Xpc	UTSW	6	91499531	missense	probably benign	0.23
R8002:Xpc	UTSW	6	91492305	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GGATACTGTTAACCGCCAAACC -3'
(R):5'- TAACCCCTTCCTTGTCAGAAGC -3'

Sequencing Primer
(F):5'- GCCAAACCTATGGTGAAGTGCAC -3'
(R):5'- GAAGCATGCTCACCACTGTG -3'

Posted On

2020-01-17