Incidental Mutation 'R7581:Xpc'
ID615930
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Namexeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R7581 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location91489305-91515888 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 91498017 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182]
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5430403G16Rik G A 5: 109,690,788 probably benign Het
Adamts9 A C 6: 92,937,338 D196E probably benign Het
Adnp A T 2: 168,183,466 D636E probably damaging Het
Afdn T C 17: 13,849,238 V723A probably damaging Het
Arid1a A T 4: 133,680,351 F1897I unknown Het
Atp6v0b T C 4: 117,885,286 M137V probably benign Het
Bicd1 T A 6: 149,519,004 I784N probably damaging Het
Cckbr A G 7: 105,433,786 T119A probably benign Het
Creb5 T C 6: 53,681,237 L184P probably damaging Het
Cyp2a22 T G 7: 26,938,148 K141Q possibly damaging Het
D16Ertd472e T C 16: 78,546,557 T219A possibly damaging Het
Ep400 A T 5: 110,756,025 L236Q unknown Het
Exph5 A G 9: 53,372,557 S313G possibly damaging Het
Gm10024 T C 10: 77,711,563 V36A unknown Het
Gm5493 A G 17: 22,747,274 E44G probably damaging Het
Gtdc1 A T 2: 44,790,005 probably null Het
Invs T C 4: 48,421,909 V847A probably benign Het
Kif18b C A 11: 102,914,722 Q236H probably damaging Het
Kntc1 A G 5: 123,816,755 T2079A probably benign Het
Large2 A G 2: 92,370,193 S89P probably damaging Het
Maml3 A C 3: 51,856,768 D258E probably benign Het
Mdga2 A T 12: 66,506,255 M868K probably damaging Het
Mtss1l A G 8: 110,726,213 E30G possibly damaging Het
Muc16 T C 9: 18,645,614 I3128V unknown Het
Mug2 C T 6: 122,063,711 T740I probably damaging Het
Noc2l T C 4: 156,245,449 V612A probably benign Het
Olfr420 G A 1: 174,158,771 probably null Het
Olfr979 A T 9: 40,000,422 D268E probably damaging Het
Padi6 T C 4: 140,728,929 T585A probably benign Het
Pcdhga1 A T 18: 37,662,177 N78I probably damaging Het
Pdgfd A G 9: 6,293,894 Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 probably benign Het
Pi4ka C T 16: 17,301,060 V1307I Het
Pip5k1c A G 10: 81,308,960 N212D probably damaging Het
Plekha1 A G 7: 130,910,865 T264A probably benign Het
Polr2b A G 5: 77,326,704 R463G probably damaging Het
Psd2 T G 18: 35,979,997 D248E probably benign Het
Rag1 G T 2: 101,643,304 Q498K possibly damaging Het
Ryr3 A G 2: 112,753,027 I2853T probably damaging Het
Selenow G T 7: 15,922,382 probably null Het
Sned1 C T 1: 93,256,545 S165F probably benign Het
Spata31d1a A G 13: 59,704,139 probably null Het
Taar4 C A 10: 23,961,154 H221N probably damaging Het
Tgm6 A T 2: 130,141,285 R265W probably damaging Het
Trpm1 A T 7: 64,204,555 Q275L probably benign Het
Ulk3 T C 9: 57,592,042 L173P probably damaging Het
Urah A T 7: 140,835,627 T3S probably benign Het
Vmn1r149 A T 7: 22,437,904 V109D probably damaging Het
Zglp1 T A 9: 21,062,708 K227N probably damaging Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91492264 unclassified probably benign
IGL01108:Xpc APN 6 91493005 missense probably damaging 1.00
IGL01310:Xpc APN 6 91490107 missense probably benign 0.02
IGL01323:Xpc APN 6 91492353 missense probably damaging 1.00
IGL01350:Xpc APN 6 91500011 missense probably benign 0.01
IGL01656:Xpc APN 6 91505467 missense probably damaging 0.98
IGL01922:Xpc APN 6 91505425 missense probably damaging 1.00
IGL02412:Xpc APN 6 91499785 missense probably benign 0.01
IGL02448:Xpc APN 6 91515744 missense probably benign 0.00
IGL02571:Xpc APN 6 91504071 missense probably benign 0.00
IGL02937:Xpc APN 6 91500137 missense probably damaging 1.00
IGL02951:Xpc APN 6 91506849 missense probably damaging 1.00
IGL03033:Xpc APN 6 91491315 splice site probably null
IGL03248:Xpc APN 6 91504583 missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91510481 missense probably damaging 1.00
R0031:Xpc UTSW 6 91491226 missense probably benign 0.01
R0173:Xpc UTSW 6 91504735 unclassified probably benign
R0285:Xpc UTSW 6 91498064 missense probably damaging 0.99
R0454:Xpc UTSW 6 91491226 missense probably benign 0.01
R0535:Xpc UTSW 6 91504578 missense possibly damaging 0.92
R0554:Xpc UTSW 6 91491226 missense probably benign 0.01
R0759:Xpc UTSW 6 91498142 missense probably damaging 0.99
R1426:Xpc UTSW 6 91493238 missense probably damaging 1.00
R1478:Xpc UTSW 6 91508528 missense possibly damaging 0.94
R1676:Xpc UTSW 6 91492947 missense possibly damaging 0.56
R1969:Xpc UTSW 6 91501025 splice site probably null
R2138:Xpc UTSW 6 91498122 nonsense probably null
R2237:Xpc UTSW 6 91498108 missense probably damaging 1.00
R4580:Xpc UTSW 6 91500011 missense probably benign 0.01
R5318:Xpc UTSW 6 91493010 missense probably damaging 1.00
R5567:Xpc UTSW 6 91498135 missense probably damaging 1.00
R5681:Xpc UTSW 6 91504120 missense probably damaging 1.00
R6022:Xpc UTSW 6 91499636 missense probably damaging 0.96
R6791:Xpc UTSW 6 91506857 missense probably benign 0.01
R6794:Xpc UTSW 6 91506857 missense probably benign 0.01
R6983:Xpc UTSW 6 91504023 missense probably damaging 0.99
R7214:Xpc UTSW 6 91492338 missense probably damaging 1.00
R7442:Xpc UTSW 6 91504649 missense probably damaging 1.00
R7524:Xpc UTSW 6 91499531 missense probably benign 0.23
R8002:Xpc UTSW 6 91492305 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGATACTGTTAACCGCCAAACC -3'
(R):5'- TAACCCCTTCCTTGTCAGAAGC -3'

Sequencing Primer
(F):5'- GCCAAACCTATGGTGAAGTGCAC -3'
(R):5'- GAAGCATGCTCACCACTGTG -3'
Posted On2020-01-17