Incidental Mutation 'R7581:Xpc'
ID 615930
Institutional Source Beutler Lab
Gene Symbol Xpc
Ensembl Gene ENSMUSG00000030094
Gene Name xeroderma pigmentosum, complementation group C
Synonyms
MMRRC Submission 045634-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.315) question?
Stock # R7581 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 91466287-91492870 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to T at 91474999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032182]
AlphaFold P51612
Predicted Effect probably benign
Transcript: ENSMUST00000032182
SMART Domains Protein: ENSMUSP00000032182
Gene: ENSMUSG00000030094

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
low complexity region 106 115 N/A INTRINSIC
low complexity region 118 142 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 335 352 N/A INTRINSIC
low complexity region 371 387 N/A INTRINSIC
low complexity region 425 439 N/A INTRINSIC
Pfam:Rad4 485 619 6.4e-26 PFAM
BHD_1 623 675 4.09e-25 SMART
BHD_2 677 737 4.96e-24 SMART
BHD_3 744 818 4.83e-45 SMART
low complexity region 826 835 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (47/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the nucleotide excision repair (NER) pathway. There are multiple components involved in the NER pathway, including Xeroderma pigmentosum (XP) A-G and V, Cockayne syndrome (CS) A and B, and trichothiodystrophy (TTD) group A, etc. This component, XPC, plays an important role in the early steps of global genome NER, especially in damage recognition, open complex formation, and repair protein complex formation. Mutations in this gene or some other NER components result in Xeroderma pigmentosum, a rare autosomal recessive disorder characterized by increased sensitivity to sunlight with the development of carcinomas at an early age. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants are highly susceptible to ultraviolet-induced skin tumors and exhibit a 30-fold higher somatic frequency of gene mutations at one year of age. Mutant cells exhibit impaired nucleotide excision repair. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 A C 6: 92,914,319 (GRCm39) D196E probably benign Het
Adnp A T 2: 168,025,386 (GRCm39) D636E probably damaging Het
Afdn T C 17: 14,069,500 (GRCm39) V723A probably damaging Het
Arid1a A T 4: 133,407,662 (GRCm39) F1897I unknown Het
Atp6v0b T C 4: 117,742,483 (GRCm39) M137V probably benign Het
Bicd1 T A 6: 149,420,502 (GRCm39) I784N probably damaging Het
Cckbr A G 7: 105,082,993 (GRCm39) T119A probably benign Het
Creb5 T C 6: 53,658,222 (GRCm39) L184P probably damaging Het
Cyp2a22 T G 7: 26,637,573 (GRCm39) K141Q possibly damaging Het
D16Ertd472e T C 16: 78,343,445 (GRCm39) T219A possibly damaging Het
Ep400 A T 5: 110,903,891 (GRCm39) L236Q unknown Het
Exph5 A G 9: 53,283,857 (GRCm39) S313G possibly damaging Het
Gm10024 T C 10: 77,547,397 (GRCm39) V36A unknown Het
Gm5493 A G 17: 22,966,247 (GRCm39) E44G probably damaging Het
Gtdc1 A T 2: 44,680,017 (GRCm39) probably null Het
Invs T C 4: 48,421,909 (GRCm39) V847A probably benign Het
Kif18b C A 11: 102,805,548 (GRCm39) Q236H probably damaging Het
Kntc1 A G 5: 123,954,818 (GRCm39) T2079A probably benign Het
Large2 A G 2: 92,200,538 (GRCm39) S89P probably damaging Het
Maml3 A C 3: 51,764,189 (GRCm39) D258E probably benign Het
Mdga2 A T 12: 66,553,029 (GRCm39) M868K probably damaging Het
Mtss2 A G 8: 111,452,845 (GRCm39) E30G possibly damaging Het
Muc16 T C 9: 18,556,910 (GRCm39) I3128V unknown Het
Mug2 C T 6: 122,040,670 (GRCm39) T740I probably damaging Het
Noc2l T C 4: 156,329,906 (GRCm39) V612A probably benign Het
Or10g9 A T 9: 39,911,718 (GRCm39) D268E probably damaging Het
Or6k2 G A 1: 173,986,337 (GRCm39) probably null Het
Padi6 T C 4: 140,456,240 (GRCm39) T585A probably benign Het
Pcdhga1 A T 18: 37,795,230 (GRCm39) N78I probably damaging Het
Pdgfd A G 9: 6,293,894 (GRCm39) Y156C probably damaging Het
Peg10 GCACATCAGGATCC GCACATCAGGATCCCCATCAGGATCCTCCACATCAGGATCC 6: 4,756,452 (GRCm39) probably benign Het
Pi4ka C T 16: 17,118,924 (GRCm39) V1307I Het
Pip5k1c A G 10: 81,144,794 (GRCm39) N212D probably damaging Het
Plekha1 A G 7: 130,512,595 (GRCm39) T264A probably benign Het
Polr2b A G 5: 77,474,551 (GRCm39) R463G probably damaging Het
Psd2 T G 18: 36,113,050 (GRCm39) D248E probably benign Het
Rag1 G T 2: 101,473,649 (GRCm39) Q498K possibly damaging Het
Ryr3 A G 2: 112,583,372 (GRCm39) I2853T probably damaging Het
Selenow G T 7: 15,656,307 (GRCm39) probably null Het
Sned1 C T 1: 93,184,267 (GRCm39) S165F probably benign Het
Spata31d1a A G 13: 59,851,953 (GRCm39) probably null Het
Taar4 C A 10: 23,837,052 (GRCm39) H221N probably damaging Het
Tgm6 A T 2: 129,983,205 (GRCm39) R265W probably damaging Het
Trpm1 A T 7: 63,854,303 (GRCm39) Q275L probably benign Het
Ulk3 T C 9: 57,499,325 (GRCm39) L173P probably damaging Het
Urah A T 7: 140,415,540 (GRCm39) T3S probably benign Het
Vmn1r149 A T 7: 22,137,329 (GRCm39) V109D probably damaging Het
Zfp1007 G A 5: 109,838,654 (GRCm39) probably benign Het
Zglp1 T A 9: 20,974,004 (GRCm39) K227N probably damaging Het
Other mutations in Xpc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Xpc APN 6 91,469,246 (GRCm39) unclassified probably benign
IGL01108:Xpc APN 6 91,469,987 (GRCm39) missense probably damaging 1.00
IGL01310:Xpc APN 6 91,467,089 (GRCm39) missense probably benign 0.02
IGL01323:Xpc APN 6 91,469,335 (GRCm39) missense probably damaging 1.00
IGL01350:Xpc APN 6 91,476,993 (GRCm39) missense probably benign 0.01
IGL01656:Xpc APN 6 91,482,449 (GRCm39) missense probably damaging 0.98
IGL01922:Xpc APN 6 91,482,407 (GRCm39) missense probably damaging 1.00
IGL02412:Xpc APN 6 91,476,767 (GRCm39) missense probably benign 0.01
IGL02448:Xpc APN 6 91,492,726 (GRCm39) missense probably benign 0.00
IGL02571:Xpc APN 6 91,481,053 (GRCm39) missense probably benign 0.00
IGL02937:Xpc APN 6 91,477,119 (GRCm39) missense probably damaging 1.00
IGL02951:Xpc APN 6 91,483,831 (GRCm39) missense probably damaging 1.00
IGL03033:Xpc APN 6 91,468,297 (GRCm39) splice site probably null
IGL03248:Xpc APN 6 91,481,565 (GRCm39) missense probably damaging 0.99
IGL03046:Xpc UTSW 6 91,487,463 (GRCm39) missense probably damaging 1.00
R0031:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0173:Xpc UTSW 6 91,481,717 (GRCm39) unclassified probably benign
R0285:Xpc UTSW 6 91,475,046 (GRCm39) missense probably damaging 0.99
R0454:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0535:Xpc UTSW 6 91,481,560 (GRCm39) missense possibly damaging 0.92
R0554:Xpc UTSW 6 91,468,208 (GRCm39) missense probably benign 0.01
R0759:Xpc UTSW 6 91,475,124 (GRCm39) missense probably damaging 0.99
R1426:Xpc UTSW 6 91,470,220 (GRCm39) missense probably damaging 1.00
R1478:Xpc UTSW 6 91,485,510 (GRCm39) missense possibly damaging 0.94
R1676:Xpc UTSW 6 91,469,929 (GRCm39) missense possibly damaging 0.56
R1969:Xpc UTSW 6 91,478,007 (GRCm39) splice site probably null
R2138:Xpc UTSW 6 91,475,104 (GRCm39) nonsense probably null
R2237:Xpc UTSW 6 91,475,090 (GRCm39) missense probably damaging 1.00
R4580:Xpc UTSW 6 91,476,993 (GRCm39) missense probably benign 0.01
R5318:Xpc UTSW 6 91,469,992 (GRCm39) missense probably damaging 1.00
R5567:Xpc UTSW 6 91,475,117 (GRCm39) missense probably damaging 1.00
R5681:Xpc UTSW 6 91,481,102 (GRCm39) missense probably damaging 1.00
R6022:Xpc UTSW 6 91,476,618 (GRCm39) missense probably damaging 0.96
R6791:Xpc UTSW 6 91,483,839 (GRCm39) missense probably benign 0.01
R6794:Xpc UTSW 6 91,483,839 (GRCm39) missense probably benign 0.01
R6983:Xpc UTSW 6 91,481,005 (GRCm39) missense probably damaging 0.99
R7214:Xpc UTSW 6 91,469,320 (GRCm39) missense probably damaging 1.00
R7442:Xpc UTSW 6 91,481,631 (GRCm39) missense probably damaging 1.00
R7524:Xpc UTSW 6 91,476,513 (GRCm39) missense probably benign 0.23
R8002:Xpc UTSW 6 91,469,287 (GRCm39) missense probably damaging 0.98
R8992:Xpc UTSW 6 91,477,956 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- GGATACTGTTAACCGCCAAACC -3'
(R):5'- TAACCCCTTCCTTGTCAGAAGC -3'

Sequencing Primer
(F):5'- GCCAAACCTATGGTGAAGTGCAC -3'
(R):5'- GAAGCATGCTCACCACTGTG -3'
Posted On 2020-01-17