Incidental Mutation 'R7560:Olfr561'
ID615933
Institutional Source Beutler Lab
Gene Symbol Olfr561
Ensembl Gene ENSMUSG00000073966
Gene Nameolfactory receptor 561
SynonymsMOR14-2, GA_x6K02T2PBJ9-5491151-5492095
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R7560 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102771221-102776857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102781682 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 69 (S69P)
Ref Sequence ENSEMBL: ENSMUSP00000148106 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000210779
AA Change: S69P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000213432
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik T C 10: 82,284,615 Y4187C probably damaging Het
Acot12 A G 13: 91,784,391 D502G probably benign Het
Adrb1 T C 19: 56,722,688 V106A probably damaging Het
Ahcyl2 G T 6: 29,886,140 G352W probably damaging Het
Ahnak2 T G 12: 112,779,674 D446A Het
AI481877 T C 4: 59,076,140 N601S possibly damaging Het
Arhgap42 T C 9: 9,035,531 D270G probably benign Het
Atp2a1 A G 7: 126,459,656 V129A possibly damaging Het
B9d2 G A 7: 25,681,359 probably benign Het
Bace1 A T 9: 45,856,139 I207F possibly damaging Het
Blnk T A 19: 40,952,390 I190F possibly damaging Het
Bmp7 C T 2: 172,939,964 E36K possibly damaging Het
Brsk2 A G 7: 142,000,860 E654G probably benign Het
Cacna2d3 T C 14: 29,058,421 H661R probably benign Het
Cdh4 T C 2: 179,890,902 V719A probably benign Het
Cdkn2d G T 9: 21,289,244 P77H probably damaging Het
Chd3 A G 11: 69,356,270 V1024A probably damaging Het
Chsy1 T A 7: 66,171,244 M409K possibly damaging Het
Chsy1 T C 7: 66,171,571 L518P probably damaging Het
Cic G A 7: 25,272,853 V670M probably damaging Het
Clock A T 5: 76,242,891 probably null Het
Coro1a C A 7: 126,703,134 V14L probably damaging Het
Ctcfl C A 2: 173,118,406 C128F probably damaging Het
Cyb5b A G 8: 107,169,859 T71A probably damaging Het
Cyp2c40 C G 19: 39,807,214 V174L possibly damaging Het
D630045J12Rik T A 6: 38,196,627 Q202L possibly damaging Het
Dgkz T C 2: 91,942,815 probably benign Het
Dlgap2 T C 8: 14,822,697 probably null Het
Dnah1 T C 14: 31,304,983 I695V probably benign Het
Dst T A 1: 34,182,451 S2445R possibly damaging Het
Elob T C 17: 23,824,976 D83G probably benign Het
Elp4 T A 2: 105,794,588 D320V probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Etfdh T C 3: 79,623,579 Y45C probably damaging Het
Exph5 A G 9: 53,375,773 I1385V probably benign Het
Fam104a C T 11: 113,663,389 G160D probably damaging Het
Fat3 A T 9: 15,996,842 D2621E probably damaging Het
Fbxl6 G T 15: 76,538,469 A83D probably benign Het
Fmo2 A G 1: 162,888,749 Y90H probably damaging Het
Fzd4 T A 7: 89,407,553 Y269* probably null Het
Grik5 T A 7: 25,058,526 I377F probably damaging Het
Havcr2 C A 11: 46,459,062 P137Q probably damaging Het
Hectd4 A G 5: 121,254,342 N223S possibly damaging Het
Hmcn2 A G 2: 31,457,173 S4792G probably benign Het
Hps3 T G 3: 20,030,452 I191L probably benign Het
Ica1l T A 1: 60,010,210 K195* probably null Het
Idh2 TCCCAGGGCC TCC 7: 80,098,331 probably null Het
Ift140 A G 17: 25,092,341 D1170G probably benign Het
Igflr1 T C 7: 30,567,351 F208S possibly damaging Het
Kcnma1 T C 14: 23,530,242 T313A probably benign Het
Krt6a T A 15: 101,690,559 I524F unknown Het
Lce1d G T 3: 92,685,841 H88Q unknown Het
Lrmda A G 14: 22,828,702 E177G probably benign Het
Lrrn3 T A 12: 41,452,713 N535I possibly damaging Het
Map2k4 T A 11: 65,775,757 I40L unknown Het
Map7d1 A G 4: 126,236,636 L459P probably damaging Het
Mipol1 A T 12: 57,306,073 N66I possibly damaging Het
Mycn A C 12: 12,940,291 F35V probably benign Het
Mzt2 A C 16: 15,862,805 M40R possibly damaging Het
N4bp2 T G 5: 65,791,115 L363V probably damaging Het
Nfat5 T A 8: 107,370,589 M1532K probably benign Het
Notch1 G A 2: 26,460,165 T2321M probably benign Het
Nr1h4 T C 10: 89,498,261 D89G probably benign Het
Nsun4 G A 4: 116,051,494 T623I possibly damaging Het
Nup155 T C 15: 8,155,047 S1309P probably benign Het
Olfr1100 T C 2: 86,978,778 Y6C probably benign Het
Olfr1508 T C 14: 52,463,394 N205S probably damaging Het
Pcsk5 A G 19: 17,836,972 F61L probably benign Het
Phrf1 A T 7: 141,231,225 probably null Het
Pkd1 G A 17: 24,573,631 E1431K probably benign Het
Pkd2 T A 5: 104,480,353 I431N probably damaging Het
Plcb2 A G 2: 118,715,643 L557P probably damaging Het
Poteg A G 8: 27,494,960 N449S probably benign Het
Ppargc1b C A 18: 61,312,210 G192W probably damaging Het
Rab13 T C 3: 90,224,899 S178P probably benign Het
Ralgds A G 2: 28,547,595 D571G probably damaging Het
Ror2 A G 13: 53,110,813 S748P probably benign Het
Sart1 A T 19: 5,384,877 L167Q probably damaging Het
Sept12 A G 16: 4,992,191 V160A possibly damaging Het
Sgo1 T C 17: 53,679,267 S299G probably benign Het
Slc35b4 T A 6: 34,163,361 D152V probably benign Het
Specc1 T A 11: 62,128,409 probably null Het
Synj1 G A 16: 90,940,483 T1308I probably benign Het
Thap12 T G 7: 98,710,231 L106V probably damaging Het
Togaram1 T C 12: 65,011,142 M1501T possibly damaging Het
Top2a G T 11: 99,000,837 N1153K probably benign Het
Trpm5 A G 7: 143,080,986 L658P probably damaging Het
Ttc21b G A 2: 66,217,204 A849V possibly damaging Het
Vmn1r80 A T 7: 12,193,823 I287F probably damaging Het
Vmn1r87 T C 7: 13,131,818 S181G probably damaging Het
Vmn2r71 A T 7: 85,623,907 H643L probably benign Het
Washc5 G A 15: 59,366,192 R228C probably damaging Het
Wdr72 T C 9: 74,210,126 S719P probably damaging Het
Xrcc3 G T 12: 111,807,902 D164E probably benign Het
Zc2hc1b G A 10: 13,168,785 R45C probably damaging Het
Zfp335 A G 2: 164,895,992 Y900H probably damaging Het
Zfp512b G A 2: 181,587,082 R697C probably damaging Het
Zfp60 T C 7: 27,749,136 Y410H probably damaging Het
Zfp60 T A 7: 27,749,271 C455S probably damaging Het
Zfp605 C T 5: 110,127,291 Q92* probably null Het
Zfp64 C T 2: 168,925,665 D676N probably damaging Het
Other mutations in Olfr561
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr561 APN 7 102774907 missense probably damaging 0.99
IGL02743:Olfr561 APN 7 102775298 missense probably damaging 0.99
IGL03001:Olfr561 APN 7 102775253 missense probably damaging 0.98
R0254:Olfr561 UTSW 7 102774869 nonsense probably null
R0356:Olfr561 UTSW 7 102775079 missense probably damaging 1.00
R0514:Olfr561 UTSW 7 102775332 missense probably benign 0.00
R0725:Olfr561 UTSW 7 102774532 missense probably benign
R0739:Olfr561 UTSW 7 102774665 missense probably damaging 1.00
R1900:Olfr561 UTSW 7 102775331 missense probably benign 0.19
R2080:Olfr561 UTSW 7 102775243 missense probably benign 0.02
R2212:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R2379:Olfr561 UTSW 7 102774845 missense probably benign 0.33
R3412:Olfr561 UTSW 7 102774755 missense possibly damaging 0.77
R3834:Olfr561 UTSW 7 102775286 missense probably damaging 1.00
R4117:Olfr561 UTSW 7 102774477 splice site probably null
R4363:Olfr561 UTSW 7 102775256 missense probably benign 0.34
R4401:Olfr561 UTSW 7 102774799 nonsense probably null
R5176:Olfr561 UTSW 7 102775306 missense probably damaging 0.99
R5464:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5465:Olfr561 UTSW 7 102775433 missense probably benign 0.00
R5493:Olfr561 UTSW 7 102775108 missense probably benign 0.00
R5540:Olfr561 UTSW 7 102774929 missense probably benign 0.02
R5629:Olfr561 UTSW 7 102774640 missense possibly damaging 0.63
R6227:Olfr561 UTSW 7 102774676 missense probably damaging 0.98
R6367:Olfr561 UTSW 7 102774829 missense possibly damaging 0.92
R6497:Olfr561 UTSW 7 102775450 missense probably benign 0.00
R7219:Olfr561 UTSW 7 102781706 missense probably benign 0.00
R7243:Olfr561 UTSW 7 102781658 missense probably benign
R7289:Olfr561 UTSW 7 102775427 missense probably damaging 1.00
R7731:Olfr561 UTSW 7 102774934 missense probably benign 0.05
R8025:Olfr561 UTSW 7 102775256 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- GGACACTCAGCTGAAAATACTG -3'
(R):5'- GGAGATGGCCACATAACGATC -3'

Sequencing Primer
(F):5'- TTAGAGAACACCACAGCTTCTTC -3'
(R):5'- GATGGCCACATAACGATCAAAAG -3'
Posted On2020-01-17