Incidental Mutation 'R7453:Rufy4'
ID615939
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R7453 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 74129334 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134] [ENSMUST00000169786] [ENSMUST00000191104] [ENSMUST00000212888]
Predicted Effect probably null
Transcript: ENSMUST00000080167
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000127134
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169786
SMART Domains Protein: ENSMUSP00000127715
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 1.77e-2 SMART
low complexity region 154 167 N/A INTRINSIC
SCOP:d1d5ra2 176 348 3e-32 SMART
PTEN_C2 350 477 1.12e-51 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1227 1239 N/A INTRINSIC
low complexity region 1284 1300 N/A INTRINSIC
low complexity region 1459 1470 N/A INTRINSIC
low complexity region 1518 1530 N/A INTRINSIC
SH2 1614 1716 6.85e-17 SMART
PTB 1747 1888 1.69e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191104
SMART Domains Protein: ENSMUSP00000140317
Gene: ENSMUSG00000055322

DomainStartEndE-ValueType
low complexity region 15 33 N/A INTRINSIC
C1 62 108 8.6e-5 SMART
low complexity region 154 167 N/A INTRINSIC
PTPc_DSPc 241 363 9.9e-6 SMART
PTEN_C2 350 477 5.6e-56 SMART
low complexity region 822 833 N/A INTRINSIC
low complexity region 905 922 N/A INTRINSIC
low complexity region 1206 1218 N/A INTRINSIC
low complexity region 1263 1279 N/A INTRINSIC
low complexity region 1438 1449 N/A INTRINSIC
low complexity region 1497 1509 N/A INTRINSIC
SH2 1593 1695 4.3e-19 SMART
PTB 1726 1867 9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000212888
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 156,003,389 S32P possibly damaging Het
Acaca T C 11: 84,245,310 V497A probably benign Het
Acox1 T C 11: 116,180,961 T214A probably benign Het
Adgrb2 G A 4: 130,014,637 probably null Het
Adh1 G A 3: 138,289,941 probably null Het
Angptl1 G T 1: 156,844,851 M82I probably benign Het
Arg1 A G 10: 24,915,776 L269P probably damaging Het
Arid2 T G 15: 96,370,724 V906G probably benign Het
Arid5b A T 10: 68,243,164 H114Q probably benign Het
Atad5 T C 11: 80,119,143 probably null Het
AU040320 G A 4: 126,835,700 probably null Het
B230104I21Rik A T 4: 154,347,728 T44S unknown Het
BC024063 G A 10: 82,110,157 R537H possibly damaging Het
Bfsp2 A T 9: 103,453,107 L177Q probably damaging Het
Birc5 C A 11: 117,852,681 H80Q probably damaging Het
Bpifb9a T C 2: 154,264,695 L382P probably damaging Het
Ces2c A T 8: 104,849,670 N105I probably benign Het
Cflar G A 1: 58,753,797 V441M Het
Ckap4 A G 10: 84,528,599 V200A probably damaging Het
Clec16a C A 16: 10,644,822 T668N probably damaging Het
Cntrl A C 2: 35,155,409 E1376D possibly damaging Het
Col18a1 A T 10: 77,085,210 probably null Het
Coq2 T C 5: 100,663,586 Y179C probably benign Het
Cpne6 A G 14: 55,512,016 E11G probably benign Het
Cr2 A C 1: 195,165,257 probably null Het
Csf2rb2 C T 15: 78,285,291 D555N probably benign Het
Cyp2j12 A T 4: 96,102,126 V401D possibly damaging Het
Dbp C T 7: 45,705,703 A27V probably benign Het
Dll1 C A 17: 15,374,889 R42L probably benign Het
Dst C A 1: 34,191,358 H2677Q possibly damaging Het
Efl1 G T 7: 82,681,467 V283F possibly damaging Het
Enah C T 1: 181,961,905 C7Y unknown Het
Fam193a A T 5: 34,464,116 E1139V possibly damaging Het
Fbn1 G A 2: 125,320,959 P2136S possibly damaging Het
Fggy T C 4: 95,597,690 V91A probably damaging Het
Fn1 T A 1: 71,590,880 D2343V probably damaging Het
Galk2 T C 2: 125,887,861 V54A possibly damaging Het
Glb1l T A 1: 75,202,706 Y193F probably damaging Het
Gm45861 G T 8: 27,541,658 R867L unknown Het
Grin2b T C 6: 135,740,949 D715G possibly damaging Het
Hltf A T 3: 20,082,752 R384S possibly damaging Het
Hs3st1 A G 5: 39,614,967 M111T probably damaging Het
Idua A G 5: 108,681,496 T388A probably benign Het
Kat14 T C 2: 144,380,734 S136P possibly damaging Het
Kif24 A C 4: 41,394,673 C867W possibly damaging Het
Klhdc10 T A 6: 30,447,990 probably null Het
Klra10 A G 6: 130,280,364 V59A probably damaging Het
Limk1 T A 5: 134,669,237 I223F probably damaging Het
Lrp10 G A 14: 54,468,456 G368S probably damaging Het
Lrrc7 T C 3: 158,185,409 R374G probably benign Het
Lypd1 T A 1: 125,873,566 M66L probably benign Het
Maats1 A G 16: 38,321,479 S364P possibly damaging Het
Mast4 C T 13: 102,804,641 probably null Het
Mbp C T 18: 82,554,643 H155Y probably damaging Het
Micu3 G A 8: 40,335,898 C150Y probably benign Het
Mras C T 9: 99,389,740 V174I probably benign Het
Mroh1 T A 15: 76,433,545 I827N probably damaging Het
Ms4a12 C A 19: 11,225,662 G101* probably null Het
Mylk2 A T 2: 152,912,433 K149M probably damaging Het
Myom3 T A 4: 135,801,035 L1064I probably damaging Het
Naa30 A G 14: 49,187,687 *365W probably null Het
Ncoa1 C T 12: 4,259,307 G1330R probably damaging Het
Nhlh1 T A 1: 172,054,279 T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 Q110R probably benign Het
Nostrin T C 2: 69,183,896 Y399H possibly damaging Het
Nsfl1c C A 2: 151,509,511 T263K possibly damaging Het
Nup153 T C 13: 46,681,181 T1456A probably damaging Het
Olfr116 G T 17: 37,624,385 D83E probably benign Het
Olfr154 T A 2: 85,664,180 M85L probably benign Het
Olfr558 T A 7: 102,709,517 I86N probably damaging Het
Olfr67 T A 7: 103,787,672 I202F possibly damaging Het
Olfr933 A T 9: 38,976,204 H176L probably damaging Het
Olfr97 T C 17: 37,231,980 Y130C probably damaging Het
Pan3 G A 5: 147,526,681 probably null Het
Pcdhgb2 C T 18: 37,691,015 T353I probably damaging Het
Pcif1 A T 2: 164,888,364 H339L probably damaging Het
Pcif1 A G 2: 164,889,630 H501R possibly damaging Het
Pcnt T C 10: 76,389,450 H1740R probably benign Het
Polr1b T A 2: 129,125,663 I992N probably damaging Het
Ppfia2 C T 10: 106,927,830 T1228M possibly damaging Het
Ppp2r5e A G 12: 75,462,342 F388L probably damaging Het
Ptpre G T 7: 135,538,074 R4L unknown Het
Pzp G T 6: 128,486,916 P1410T probably damaging Het
Qrich1 A C 9: 108,556,476 K656T possibly damaging Het
Rabep1 C T 11: 70,917,660 P481S probably damaging Het
Rgs9 T A 11: 109,227,268 R579W probably damaging Het
Rhot1 T C 11: 80,248,540 probably null Het
Rnf123 T A 9: 108,070,408 probably null Het
Rreb1 T G 13: 37,941,569 C1284G probably damaging Het
Rsph4a A G 10: 33,909,293 E400G probably benign Het
S100pbp A G 4: 129,182,085 L149P probably damaging Het
Sall3 T C 18: 80,972,040 D891G probably benign Het
Scn10a C T 9: 119,638,552 V841I probably benign Het
Scn5a T A 9: 119,522,590 Y775F possibly damaging Het
Sec62 A T 3: 30,809,796 probably null Het
Slc24a1 A T 9: 64,949,301 M108K unknown Het
Spata22 T A 11: 73,335,990 probably null Het
Stk4 A G 2: 164,086,602 N118S probably benign Het
Stt3a A T 9: 36,747,970 S358T possibly damaging Het
Tbc1d31 T A 15: 57,950,995 F531I probably damaging Het
Tfrc A G 16: 32,619,049 T307A probably damaging Het
Thegl A G 5: 77,060,786 H387R probably damaging Het
Tnpo2 T C 8: 85,055,022 I811T probably damaging Het
Ttc23l T C 15: 10,533,767 Y230C probably damaging Het
Ttll13 A G 7: 80,260,434 D775G probably benign Het
Ttn T C 2: 76,944,929 K1969R unknown Het
Ube2s G A 7: 4,810,436 R110* probably null Het
Ubxn11 G A 4: 134,126,229 R364Q probably benign Het
Unc13d T C 11: 116,067,871 Q773R probably benign Het
Ush2a T C 1: 188,553,111 V1948A probably damaging Het
Vmn1r205 A T 13: 22,592,761 I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,411,560 probably null Het
Vmn2r71 A T 7: 85,624,089 T704S probably benign Het
Vmn2r93 T A 17: 18,313,318 S495T probably benign Het
Wiz T A 17: 32,379,075 I102F probably benign Het
Zan A C 5: 137,466,002 L514V probably damaging Het
Zfp106 T A 2: 120,510,527 N1857I probably damaging Het
Zfp106 A T 2: 120,545,919 probably null Het
Zfp738 T C 13: 67,670,355 T506A probably benign Het
Zfp934 T C 13: 62,518,703 N53S probably benign Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4234:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4779:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5226:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5372:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTTTCCCCTGAGAGGTGAGG -3'
(R):5'- GCCCAAGTATGCCAAACTGC -3'

Sequencing Primer
(F):5'- GAGGACCTCTCATTAGCCCTG -3'
(R):5'- TGCATGCAGGACTCTCAGG -3'
Posted On2020-01-23