Incidental Mutation 'R7453:Cr2'
ID 615940
Institutional Source Beutler Lab
Gene Symbol Cr2
Ensembl Gene ENSMUSG00000026616
Gene Name complement receptor 2
Synonyms C3DR, CD21, Cr-2, Cr1, Cr-1, CD35
MMRRC Submission 045527-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R7453 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194819119-194859024 bp(-) (GRCm39)
Type of Mutation splice site (11296 bp from exon)
DNA Base Change (assembly) A to C at 194847565 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043104] [ENSMUST00000082321] [ENSMUST00000193801] [ENSMUST00000195120] [ENSMUST00000210219]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000043104
SMART Domains Protein: ENSMUSP00000044261
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 2 58 5.04e-7 SMART
CCP 63 120 3.58e-12 SMART
CCP 125 191 1.2e-13 SMART
CCP 197 252 2.73e-17 SMART
CCP 256 311 1.01e-15 SMART
Blast:CCP 316 347 2e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000082321
SMART Domains Protein: ENSMUSP00000080938
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 1.01e-11 SMART
CCP 91 147 9.1e-14 SMART
CCP 155 211 1.9e-16 SMART
CCP 216 272 1.6e-9 SMART
CCP 277 343 1.01e-11 SMART
CCP 352 407 1.2e-13 SMART
CCP 411 467 2.34e-16 SMART
CCP 472 523 1.24e0 SMART
CCP 528 594 4.48e-13 SMART
CCP 603 658 1.95e-13 SMART
CCP 718 778 1.75e-15 SMART
CCP 787 842 2.06e-12 SMART
CCP 850 906 7.92e-14 SMART
CCP 911 967 1.29e-13 SMART
transmembrane domain 975 997 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000193801
SMART Domains Protein: ENSMUSP00000141276
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195120
SMART Domains Protein: ENSMUSP00000141538
Gene: ENSMUSG00000026616

DomainStartEndE-ValueType
CCP 23 82 4.9e-14 SMART
CCP 91 147 4.5e-16 SMART
CCP 155 211 9.1e-19 SMART
CCP 216 272 8e-12 SMART
CCP 277 343 5e-14 SMART
CCP 352 407 5.9e-16 SMART
CCP 411 467 1.1e-18 SMART
CCP 472 523 6.1e-3 SMART
CCP 528 594 2.2e-15 SMART
CCP 603 658 9.4e-16 SMART
CCP 718 778 8.3e-18 SMART
CCP 787 842 1e-14 SMART
CCP 850 906 4e-16 SMART
CCP 911 967 6.2e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210219
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (122/122)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein, which functions as a receptor for Epstein-Barr virus (EBV) binding on B and T lymphocytes. Genetic variations in this gene are associated with susceptibility to systemic lupus erythematosus type 9 (SLEB9). Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired humoral immune responses to T cell-dependent antigens, with limited affinity maturation, and reduced memory B cell and germinal center formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 120 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430550D23Rik A G 2: 155,845,309 (GRCm39) S32P possibly damaging Het
Acaca T C 11: 84,136,136 (GRCm39) V497A probably benign Het
Acox1 T C 11: 116,071,787 (GRCm39) T214A probably benign Het
Adgrb2 G A 4: 129,908,430 (GRCm39) probably null Het
Adh1 G A 3: 137,995,702 (GRCm39) probably null Het
Angptl1 G T 1: 156,672,421 (GRCm39) M82I probably benign Het
Arg1 A G 10: 24,791,674 (GRCm39) L269P probably damaging Het
Arid2 T G 15: 96,268,605 (GRCm39) V906G probably benign Het
Arid5b A T 10: 68,078,994 (GRCm39) H114Q probably benign Het
Atad5 T C 11: 80,009,969 (GRCm39) probably null Het
AU040320 G A 4: 126,729,493 (GRCm39) probably null Het
B230104I21Rik A T 4: 154,432,185 (GRCm39) T44S unknown Het
BC024063 G A 10: 81,945,991 (GRCm39) R537H possibly damaging Het
Bfsp2 A T 9: 103,330,306 (GRCm39) L177Q probably damaging Het
Birc5 C A 11: 117,743,507 (GRCm39) H80Q probably damaging Het
Bpifb9a T C 2: 154,106,615 (GRCm39) L382P probably damaging Het
Ces2c A T 8: 105,576,302 (GRCm39) N105I probably benign Het
Cfap91 A G 16: 38,141,841 (GRCm39) S364P possibly damaging Het
Cflar G A 1: 58,792,956 (GRCm39) V441M Het
Ckap4 A G 10: 84,364,463 (GRCm39) V200A probably damaging Het
Clec16a C A 16: 10,462,686 (GRCm39) T668N probably damaging Het
Cntrl A C 2: 35,045,421 (GRCm39) E1376D possibly damaging Het
Col18a1 A T 10: 76,921,044 (GRCm39) probably null Het
Coq2 T C 5: 100,811,452 (GRCm39) Y179C probably benign Het
Cpne6 A G 14: 55,749,473 (GRCm39) E11G probably benign Het
Csf2rb2 C T 15: 78,169,491 (GRCm39) D555N probably benign Het
Cyp2j12 A T 4: 95,990,363 (GRCm39) V401D possibly damaging Het
Dbp C T 7: 45,355,127 (GRCm39) A27V probably benign Het
Dll1 C A 17: 15,595,151 (GRCm39) R42L probably benign Het
Dst C A 1: 34,230,439 (GRCm39) H2677Q possibly damaging Het
Efl1 G T 7: 82,330,675 (GRCm39) V283F possibly damaging Het
Enah C T 1: 181,789,470 (GRCm39) C7Y unknown Het
Fam193a A T 5: 34,621,460 (GRCm39) E1139V possibly damaging Het
Fbn1 G A 2: 125,162,879 (GRCm39) P2136S possibly damaging Het
Fggy T C 4: 95,485,927 (GRCm39) V91A probably damaging Het
Fn1 T A 1: 71,630,039 (GRCm39) D2343V probably damaging Het
Galk2 T C 2: 125,729,781 (GRCm39) V54A possibly damaging Het
Glb1l T A 1: 75,179,350 (GRCm39) Y193F probably damaging Het
Gm45861 G T 8: 28,031,686 (GRCm39) R867L unknown Het
Grin2b T C 6: 135,717,947 (GRCm39) D715G possibly damaging Het
Hltf A T 3: 20,136,916 (GRCm39) R384S possibly damaging Het
Hs3st1 A G 5: 39,772,310 (GRCm39) M111T probably damaging Het
Idua A G 5: 108,829,362 (GRCm39) T388A probably benign Het
Kat14 T C 2: 144,222,654 (GRCm39) S136P possibly damaging Het
Kif24 A C 4: 41,394,673 (GRCm39) C867W possibly damaging Het
Klhdc10 T A 6: 30,447,989 (GRCm39) probably null Het
Klra10 A G 6: 130,257,327 (GRCm39) V59A probably damaging Het
Limk1 T A 5: 134,698,091 (GRCm39) I223F probably damaging Het
Lrp10 G A 14: 54,705,913 (GRCm39) G368S probably damaging Het
Lrrc7 T C 3: 157,891,046 (GRCm39) R374G probably benign Het
Lypd1 T A 1: 125,801,303 (GRCm39) M66L probably benign Het
Mast4 C T 13: 102,941,149 (GRCm39) probably null Het
Mbp C T 18: 82,572,768 (GRCm39) H155Y probably damaging Het
Micu3 G A 8: 40,788,939 (GRCm39) C150Y probably benign Het
Mras C T 9: 99,271,793 (GRCm39) V174I probably benign Het
Mroh1 T A 15: 76,317,745 (GRCm39) I827N probably damaging Het
Ms4a12 C A 19: 11,203,026 (GRCm39) G101* probably null Het
Mylk2 A T 2: 152,754,353 (GRCm39) K149M probably damaging Het
Myom3 T A 4: 135,528,346 (GRCm39) L1064I probably damaging Het
Naa30 A G 14: 49,425,144 (GRCm39) *365W probably null Het
Ncoa1 C T 12: 4,309,307 (GRCm39) G1330R probably damaging Het
Nhlh1 T A 1: 171,881,846 (GRCm39) T7S probably benign Het
Nipsnap3a A G 4: 52,995,882 (GRCm39) Q110R probably benign Het
Nostrin T C 2: 69,014,240 (GRCm39) Y399H possibly damaging Het
Nsfl1c C A 2: 151,351,431 (GRCm39) T263K possibly damaging Het
Nup153 T C 13: 46,834,657 (GRCm39) T1456A probably damaging Het
Or14j10 G T 17: 37,935,276 (GRCm39) D83E probably benign Het
Or1o2 T C 17: 37,542,871 (GRCm39) Y130C probably damaging Het
Or51e1 T A 7: 102,358,724 (GRCm39) I86N probably damaging Het
Or52z1 T A 7: 103,436,879 (GRCm39) I202F possibly damaging Het
Or5g26 T A 2: 85,494,524 (GRCm39) M85L probably benign Het
Or8d1b A T 9: 38,887,500 (GRCm39) H176L probably damaging Het
Pan3 G A 5: 147,463,491 (GRCm39) probably null Het
Pcdhgb2 C T 18: 37,824,068 (GRCm39) T353I probably damaging Het
Pcif1 A T 2: 164,730,284 (GRCm39) H339L probably damaging Het
Pcif1 A G 2: 164,731,550 (GRCm39) H501R possibly damaging Het
Pcnt T C 10: 76,225,284 (GRCm39) H1740R probably benign Het
Polr1b T A 2: 128,967,583 (GRCm39) I992N probably damaging Het
Ppfia2 C T 10: 106,763,691 (GRCm39) T1228M possibly damaging Het
Ppp2r5e A G 12: 75,509,116 (GRCm39) F388L probably damaging Het
Ptpre G T 7: 135,139,803 (GRCm39) R4L unknown Het
Pzp G T 6: 128,463,879 (GRCm39) P1410T probably damaging Het
Qrich1 A C 9: 108,433,675 (GRCm39) K656T possibly damaging Het
Rabep1 C T 11: 70,808,486 (GRCm39) P481S probably damaging Het
Rgs9 T A 11: 109,118,094 (GRCm39) R579W probably damaging Het
Rhot1 T C 11: 80,139,366 (GRCm39) probably null Het
Rnf123 T A 9: 107,947,607 (GRCm39) probably null Het
Rreb1 T G 13: 38,125,545 (GRCm39) C1284G probably damaging Het
Rsph4a A G 10: 33,785,289 (GRCm39) E400G probably benign Het
Rufy4 T A 1: 74,168,493 (GRCm39) probably null Het
S100pbp A G 4: 129,075,878 (GRCm39) L149P probably damaging Het
Sall3 T C 18: 81,015,255 (GRCm39) D891G probably benign Het
Scn10a C T 9: 119,467,618 (GRCm39) V841I probably benign Het
Scn5a T A 9: 119,351,656 (GRCm39) Y775F possibly damaging Het
Sec62 A T 3: 30,863,945 (GRCm39) probably null Het
Slc24a1 A T 9: 64,856,583 (GRCm39) M108K unknown Het
Spata22 T A 11: 73,226,816 (GRCm39) probably null Het
Spmap2l A G 5: 77,208,633 (GRCm39) H387R probably damaging Het
Stk4 A G 2: 163,928,522 (GRCm39) N118S probably benign Het
Stt3a A T 9: 36,659,266 (GRCm39) S358T possibly damaging Het
Tbc1d31 T A 15: 57,814,391 (GRCm39) F531I probably damaging Het
Tfrc A G 16: 32,437,867 (GRCm39) T307A probably damaging Het
Tnpo2 T C 8: 85,781,651 (GRCm39) I811T probably damaging Het
Ttc23l T C 15: 10,533,853 (GRCm39) Y230C probably damaging Het
Ttll13 A G 7: 79,910,182 (GRCm39) D775G probably benign Het
Ttn T C 2: 76,775,273 (GRCm39) K1969R unknown Het
Ube2s G A 7: 4,813,435 (GRCm39) R110* probably null Het
Ubxn11 G A 4: 133,853,540 (GRCm39) R364Q probably benign Het
Unc13d T C 11: 115,958,697 (GRCm39) Q773R probably benign Het
Ush2a T C 1: 188,285,308 (GRCm39) V1948A probably damaging Het
Vmn1r205 A T 13: 22,776,931 (GRCm39) I57N probably damaging Het
Vmn2r69 GAAAA GAAAAA 7: 85,060,768 (GRCm39) probably null Het
Vmn2r71 A T 7: 85,273,297 (GRCm39) T704S probably benign Het
Vmn2r93 T A 17: 18,533,580 (GRCm39) S495T probably benign Het
Wiz T A 17: 32,598,049 (GRCm39) I102F probably benign Het
Zan A C 5: 137,464,264 (GRCm39) L514V probably damaging Het
Zfp106 T A 2: 120,341,008 (GRCm39) N1857I probably damaging Het
Zfp106 A T 2: 120,376,400 (GRCm39) probably null Het
Zfp738 T C 13: 67,818,474 (GRCm39) T506A probably benign Het
Zfp934 T C 13: 62,666,517 (GRCm39) N53S probably benign Het
Other mutations in Cr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Cr2 APN 1 194,836,559 (GRCm39) missense possibly damaging 0.76
IGL01326:Cr2 APN 1 194,823,529 (GRCm39) missense probably null 1.00
IGL01358:Cr2 APN 1 194,842,128 (GRCm39) missense probably damaging 1.00
IGL01410:Cr2 APN 1 194,845,542 (GRCm39) missense possibly damaging 0.49
IGL01468:Cr2 APN 1 194,850,843 (GRCm39) missense probably damaging 1.00
IGL01608:Cr2 APN 1 194,837,528 (GRCm39) missense possibly damaging 0.50
IGL01810:Cr2 APN 1 194,841,903 (GRCm39) missense possibly damaging 0.49
IGL01843:Cr2 APN 1 194,833,222 (GRCm39) splice site probably benign
IGL02332:Cr2 APN 1 194,842,630 (GRCm39) missense probably benign 0.19
IGL02934:Cr2 APN 1 194,836,633 (GRCm39) splice site probably benign
IGL02938:Cr2 APN 1 194,848,696 (GRCm39) missense probably damaging 1.00
IGL03149:Cr2 APN 1 194,848,674 (GRCm39) missense probably damaging 1.00
IGL03327:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
IGL03346:Cr2 APN 1 194,852,067 (GRCm39) missense probably damaging 1.00
Pillar UTSW 1 194,838,196 (GRCm39) nonsense probably null
PIT4354001:Cr2 UTSW 1 194,848,617 (GRCm39) missense probably damaging 1.00
PIT4418001:Cr2 UTSW 1 194,839,760 (GRCm39) missense probably benign 0.08
R0128:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0130:Cr2 UTSW 1 194,848,539 (GRCm39) missense probably damaging 0.99
R0380:Cr2 UTSW 1 194,839,715 (GRCm39) missense probably damaging 1.00
R0538:Cr2 UTSW 1 194,842,667 (GRCm39) splice site probably benign
R0605:Cr2 UTSW 1 194,845,904 (GRCm39) splice site probably benign
R0626:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.95
R1135:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R1396:Cr2 UTSW 1 194,851,561 (GRCm39) splice site probably null
R1422:Cr2 UTSW 1 194,853,433 (GRCm39) missense probably benign 0.01
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1467:Cr2 UTSW 1 194,839,817 (GRCm39) missense probably damaging 1.00
R1511:Cr2 UTSW 1 194,837,580 (GRCm39) missense possibly damaging 0.92
R1572:Cr2 UTSW 1 194,845,622 (GRCm39) missense probably damaging 1.00
R1714:Cr2 UTSW 1 194,833,994 (GRCm39) missense possibly damaging 0.46
R1748:Cr2 UTSW 1 194,838,213 (GRCm39) nonsense probably null
R1761:Cr2 UTSW 1 194,837,431 (GRCm39) critical splice donor site probably null
R1824:Cr2 UTSW 1 194,839,624 (GRCm39) missense probably damaging 1.00
R1893:Cr2 UTSW 1 194,837,495 (GRCm39) missense probably benign 0.03
R1990:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1991:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R1992:Cr2 UTSW 1 194,836,458 (GRCm39) missense possibly damaging 0.63
R2191:Cr2 UTSW 1 194,845,689 (GRCm39) missense possibly damaging 0.94
R2276:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R2277:Cr2 UTSW 1 194,839,676 (GRCm39) missense possibly damaging 0.94
R3548:Cr2 UTSW 1 194,838,196 (GRCm39) nonsense probably null
R3743:Cr2 UTSW 1 194,832,274 (GRCm39) splice site probably benign
R3941:Cr2 UTSW 1 194,848,122 (GRCm39) missense probably damaging 0.97
R3963:Cr2 UTSW 1 194,842,047 (GRCm39) missense probably damaging 1.00
R4211:Cr2 UTSW 1 194,838,636 (GRCm39) missense probably damaging 0.96
R4484:Cr2 UTSW 1 194,836,482 (GRCm39) missense probably damaging 1.00
R4546:Cr2 UTSW 1 194,853,349 (GRCm39) missense possibly damaging 0.94
R4791:Cr2 UTSW 1 194,838,243 (GRCm39) missense probably damaging 1.00
R4801:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4802:Cr2 UTSW 1 194,845,619 (GRCm39) missense probably damaging 1.00
R4874:Cr2 UTSW 1 194,858,878 (GRCm39) missense possibly damaging 0.82
R4885:Cr2 UTSW 1 194,841,039 (GRCm39) missense possibly damaging 0.92
R4889:Cr2 UTSW 1 194,858,893 (GRCm39) missense possibly damaging 0.70
R5154:Cr2 UTSW 1 194,841,754 (GRCm39) missense probably damaging 1.00
R5574:Cr2 UTSW 1 194,823,544 (GRCm39) missense probably damaging 1.00
R5594:Cr2 UTSW 1 194,839,498 (GRCm39) missense probably damaging 1.00
R5645:Cr2 UTSW 1 194,836,581 (GRCm39) missense probably damaging 1.00
R5700:Cr2 UTSW 1 194,842,065 (GRCm39) missense probably damaging 0.96
R5929:Cr2 UTSW 1 194,853,419 (GRCm39) missense possibly damaging 0.91
R6237:Cr2 UTSW 1 194,839,810 (GRCm39) missense probably damaging 1.00
R6299:Cr2 UTSW 1 194,850,954 (GRCm39) missense probably damaging 1.00
R6368:Cr2 UTSW 1 194,850,780 (GRCm39) missense probably damaging 1.00
R6406:Cr2 UTSW 1 194,852,079 (GRCm39) missense probably damaging 1.00
R6618:Cr2 UTSW 1 194,839,687 (GRCm39) missense probably damaging 0.98
R6684:Cr2 UTSW 1 194,853,329 (GRCm39) nonsense probably null
R6720:Cr2 UTSW 1 194,837,508 (GRCm39) missense probably damaging 0.97
R6866:Cr2 UTSW 1 194,833,999 (GRCm39) missense probably damaging 1.00
R6915:Cr2 UTSW 1 194,853,454 (GRCm39) missense probably benign 0.06
R7057:Cr2 UTSW 1 194,833,918 (GRCm39) missense possibly damaging 0.83
R7117:Cr2 UTSW 1 194,842,909 (GRCm39) missense possibly damaging 0.79
R7200:Cr2 UTSW 1 194,845,557 (GRCm39) missense probably damaging 1.00
R7209:Cr2 UTSW 1 194,851,032 (GRCm39) missense probably damaging 1.00
R7350:Cr2 UTSW 1 194,837,594 (GRCm39) missense probably benign 0.21
R7414:Cr2 UTSW 1 194,832,344 (GRCm39) missense probably benign
R7479:Cr2 UTSW 1 194,840,718 (GRCm39) critical splice donor site probably null
R7480:Cr2 UTSW 1 194,836,484 (GRCm39) missense probably damaging 1.00
R7570:Cr2 UTSW 1 194,851,648 (GRCm39) nonsense probably null
R7666:Cr2 UTSW 1 194,836,533 (GRCm39) missense probably damaging 1.00
R7921:Cr2 UTSW 1 194,833,975 (GRCm39) missense possibly damaging 0.94
R7923:Cr2 UTSW 1 194,850,995 (GRCm39) missense probably benign 0.03
R8396:Cr2 UTSW 1 194,840,376 (GRCm39) missense probably damaging 1.00
R8503:Cr2 UTSW 1 194,845,850 (GRCm39) missense probably benign
R8517:Cr2 UTSW 1 194,838,207 (GRCm39) missense probably benign 0.03
R8773:Cr2 UTSW 1 194,840,913 (GRCm39) missense probably damaging 1.00
R8849:Cr2 UTSW 1 194,839,547 (GRCm39) missense probably damaging 1.00
R8896:Cr2 UTSW 1 194,851,581 (GRCm39) missense possibly damaging 0.58
R8938:Cr2 UTSW 1 194,853,424 (GRCm39) missense probably damaging 0.99
R9027:Cr2 UTSW 1 194,834,029 (GRCm39) missense probably benign 0.08
R9045:Cr2 UTSW 1 194,837,680 (GRCm39) missense possibly damaging 0.61
R9116:Cr2 UTSW 1 194,840,977 (GRCm39) nonsense probably null
R9137:Cr2 UTSW 1 194,850,640 (GRCm39) critical splice donor site probably null
R9476:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9497:Cr2 UTSW 1 194,850,743 (GRCm39) missense probably damaging 0.99
R9510:Cr2 UTSW 1 194,840,416 (GRCm39) missense probably damaging 0.97
R9752:Cr2 UTSW 1 194,823,575 (GRCm39) missense probably benign 0.37
R9799:Cr2 UTSW 1 194,842,988 (GRCm39) missense probably benign 0.02
X0028:Cr2 UTSW 1 194,832,290 (GRCm39) missense probably benign 0.09
X0066:Cr2 UTSW 1 194,848,629 (GRCm39) missense probably damaging 0.99
Z1176:Cr2 UTSW 1 194,836,461 (GRCm39) missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TTTCTACTCACGTTCACAGACAG -3'
(R):5'- TTGGCAGACAGTGTCTTCC -3'

Sequencing Primer
(F):5'- CTCTCCTTCTGGGATACACTGACTAG -3'
(R):5'- GCAGACAGTGTCTTCCTTATTTTATC -3'
Posted On 2020-01-23