Incidental Mutation 'R7530:Olfr770'
ID615949
Institutional Source Beutler Lab
Gene Symbol Olfr770
Ensembl Gene ENSMUSG00000047868
Gene Nameolfactory receptor 770
SynonymsMOR114-5, GA_x6K02T2PULF-10819232-10818297
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R7530 (G1)
Quality Score78.0075
Status Validated
Chromosome10
Chromosomal Location129132578-129138998 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to C at 129133980 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062314] [ENSMUST00000203887] [ENSMUST00000204250] [ENSMUST00000204712]
Predicted Effect probably benign
Transcript: ENSMUST00000062314
SMART Domains Protein: ENSMUSP00000055193
Gene: ENSMUSG00000047868

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000203887
SMART Domains Protein: ENSMUSP00000144950
Gene: ENSMUSG00000047868

DomainStartEndE-ValueType
Pfam:7tm_4 28 107 1.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204250
SMART Domains Protein: ENSMUSP00000144892
Gene: ENSMUSG00000047868

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.2e-43 PFAM
Pfam:7tm_1 38 286 5.5e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000204712
SMART Domains Protein: ENSMUSP00000144960
Gene: ENSMUSG00000047868

DomainStartEndE-ValueType
Pfam:7tm_4 28 130 1.4e-17 PFAM
Pfam:7TM_GPCR_Srsx 32 130 2.4e-4 PFAM
Pfam:7tm_1 38 130 8.8e-16 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4430402I18Rik A T 19: 28,948,721 Y43* probably null Het
6430550D23Rik C T 2: 156,003,920 V6I probably benign Het
AI314180 A G 4: 58,815,317 M1322T probably damaging Het
Atp10a A G 7: 58,773,976 T230A probably benign Het
Atp5g2 A T 15: 102,667,748 M1K probably null Het
Atp8a1 A C 5: 67,745,628 L535R Het
Bsn A G 9: 108,111,956 I2199T probably damaging Het
Ccdc73 A G 2: 104,994,570 T155A Het
Cdc42bpg T G 19: 6,322,275 F1430L probably benign Het
Cdc42bpg G T 19: 6,322,276 V1431L probably benign Het
Chat A T 14: 32,408,958 Y575* probably null Het
Col6a4 A T 9: 106,068,390 C842S probably damaging Het
Coq2 T C 5: 100,674,142 S34G probably benign Het
Crybg1 C T 10: 43,999,073 A680T possibly damaging Het
Ctsr T A 13: 61,163,117 K38N probably damaging Het
Dpm2 T C 2: 32,572,301 F33S probably damaging Het
Ext2 T A 2: 93,661,653 H564L probably benign Het
Fbxl2 G T 9: 113,989,173 H202N probably benign Het
Fra10ac1 A T 19: 38,215,905 Y74* probably null Het
Greb1 T A 12: 16,717,206 I332F probably benign Het
Ifnar2 A G 16: 91,404,313 S481G probably benign Het
Igkv9-123 G A 6: 67,954,397 P62S possibly damaging Het
Iqub T C 6: 24,450,623 Q659R probably benign Het
Kansl2 T C 15: 98,529,015 T242A probably benign Het
Kif28 C T 1: 179,708,480 G543D probably benign Het
Lsg1 A G 16: 30,582,601 S93P possibly damaging Het
Med23 T A 10: 24,905,953 C1052S probably benign Het
Mgam G T 6: 40,709,218 probably null Het
Mtmr4 C T 11: 87,611,876 R919W probably damaging Het
Muc5ac G T 7: 141,813,799 V2986L possibly damaging Het
Myo5b A G 18: 74,731,731 E1340G probably benign Het
Nkd2 T C 13: 73,846,959 D40G possibly damaging Het
Nudt5 T C 2: 5,864,368 L135S probably damaging Het
Oca2 A C 7: 56,331,972 D614A probably damaging Het
Olfr1 A G 11: 73,388,363 V221A possibly damaging Het
Olfr1058 T A 2: 86,386,171 L82F probably damaging Het
Plec C A 15: 76,185,644 A991S unknown Het
Plekhg2 G A 7: 28,361,928 R817C probably damaging Het
Plrg1 T A 3: 83,058,682 L48H probably damaging Het
Prx A G 7: 27,507,972 E18G probably damaging Het
Ptprf T C 4: 118,212,748 Y1479C probably damaging Het
Rap1b A T 10: 117,817,452 Y159* probably null Het
Rbck1 T C 2: 152,324,292 E242G possibly damaging Het
Rxfp1 T C 3: 79,650,461 D570G probably benign Het
Slc35f5 G T 1: 125,584,538 L358F probably damaging Het
Smarcd2 A G 11: 106,265,761 W274R probably damaging Het
Ssu72 A G 4: 155,731,329 T77A probably benign Het
Tex33 T C 15: 78,386,316 D84G probably benign Het
Tomm40 G A 7: 19,702,904 T297I possibly damaging Het
Urb1 A T 16: 90,761,634 I1743N probably damaging Het
Utp20 G A 10: 88,753,006 R2434C probably damaging Het
Other mutations in Olfr770
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0787:Olfr770 UTSW 10 129133526 missense possibly damaging 0.89
R2141:Olfr770 UTSW 10 129133006 missense probably benign 0.23
R4190:Olfr770 UTSW 10 129132967 missense possibly damaging 0.86
R4397:Olfr770 UTSW 10 129133581 missense possibly damaging 0.59
R5009:Olfr770 UTSW 10 129133615 missense probably benign 0.06
R5781:Olfr770 UTSW 10 129133147 missense probably damaging 1.00
R6343:Olfr770 UTSW 10 129133666 nonsense probably null
R7492:Olfr770 UTSW 10 129133640 missense probably damaging 0.99
Z1088:Olfr770 UTSW 10 129133075 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- ACTGTATGGTTCCTCATAGTTGAC -3'
(R):5'- AGCAAGATAGGAAGCTTCTATCG -3'

Sequencing Primer
(F):5'- ATGGTTCCTCATAGTTGACTCTTG -3'
(R):5'- AGATAGGAAGCTTCTATCGAACATC -3'
Posted On2020-01-23